Incidental Mutation 'R8924:Myo9b'
ID679474
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Namemyosin IXb
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R8924 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71272714-71360713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71349031 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1277 (S1277G)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
Predicted Effect probably benign
Transcript: ENSMUST00000071935
AA Change: S1266G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: S1266G

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168839
AA Change: S1277G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: S1277G

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170242
AA Change: S1277G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: S1277G

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212935
AA Change: S1267G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,295,461 N572D probably benign Het
Abca8b A G 11: 109,947,177 V1145A probably benign Het
Atn1 A T 6: 124,745,248 S881T probably benign Het
B3galt1 C T 2: 68,118,715 T258I probably benign Het
Bahcc1 C T 11: 120,276,765 L1331F probably benign Het
Capn12 G A 7: 28,883,203 V168M probably damaging Het
Card14 T C 11: 119,326,104 V338A possibly damaging Het
Cd37 A G 7: 45,238,685 L37P probably damaging Het
Cd96 A G 16: 46,099,022 L212P probably damaging Het
Celsr1 T C 15: 86,032,470 E434G possibly damaging Het
Cep152 A G 2: 125,602,858 M456T possibly damaging Het
Ces3b G A 8: 105,084,987 R45H probably benign Het
Cfap54 T G 10: 93,001,823 T1072P probably damaging Het
Chodl A T 16: 78,941,771 M172L possibly damaging Het
Cilp2 A G 8: 69,886,458 S47P probably damaging Het
Clasrp T C 7: 19,584,307 I596V unknown Het
Clcn2 C T 16: 20,712,180 V267I probably damaging Het
Cntln T A 4: 84,888,699 D139E probably damaging Het
Cyp2j12 A C 4: 96,106,448 N379K probably damaging Het
Defb21 T C 2: 152,574,784 V60A possibly damaging Het
Dnajc16 G T 4: 141,766,707 S543* probably null Het
Efcab12 G T 6: 115,823,703 H120N probably benign Het
Efl1 G A 7: 82,762,953 G850D probably benign Het
Efna1 T C 3: 89,276,328 M64V probably benign Het
Eif2ak3 T C 6: 70,893,019 W897R probably damaging Het
Eif2ak4 T A 2: 118,428,032 F621Y probably damaging Het
Erbin C A 13: 103,839,458 E643* probably null Het
Esr1 G A 10: 4,857,176 W364* probably null Het
Fam171a2 T C 11: 102,440,035 E206G possibly damaging Het
Fam90a1a T C 8: 21,961,413 F97L probably benign Het
Fap A T 2: 62,547,821 F181I probably benign Het
Fem1b T C 9: 62,797,634 N115D probably damaging Het
Gal3st2b G T 1: 93,940,931 A295S probably benign Het
Gcfc2 T C 6: 81,932,898 V224A probably damaging Het
Gh T C 11: 106,300,808 E136G probably damaging Het
Gjd3 C T 11: 98,982,499 C173Y probably damaging Het
Gm11639 AACTCTA AA 11: 104,915,427 probably null Het
Gm12695 T A 4: 96,762,809 M136L probably benign Het
Gm156 G T 6: 129,768,121 H171N probably benign Het
Gnas A G 2: 174,299,484 E482G unknown Het
Gpa33 T C 1: 166,152,782 L138P probably damaging Het
Hlf T C 11: 90,345,888 D181G probably damaging Het
Irgm1 A G 11: 48,865,871 L387S probably benign Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Klra2 T C 6: 131,228,251 E209G probably benign Het
Klra3 C T 6: 130,335,769 V11M probably benign Het
Kmt2c T C 5: 25,298,887 S3808G probably benign Het
Krtap24-1 A C 16: 88,612,000 S79R probably benign Het
Limch1 T A 5: 67,033,132 H759Q probably benign Het
Map3k4 A G 17: 12,271,546 Y333H probably benign Het
Mmel1 A G 4: 154,889,634 Y377C probably damaging Het
Ms4a14 A T 19: 11,303,749 Y482N possibly damaging Het
Nab1 T C 1: 52,490,508 T77A possibly damaging Het
Obsl1 T C 1: 75,506,197 S10G probably benign Het
Odc1 A G 12: 17,548,328 T157A possibly damaging Het
Olfr448 T G 6: 42,897,030 L193R probably damaging Het
Olfr917 T C 9: 38,665,484 D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prdm13 G A 4: 21,679,125 A455V possibly damaging Het
Ptpn13 A T 5: 103,591,235 Y2289F probably damaging Het
Ptpn18 G T 1: 34,459,885 R21L probably benign Het
Ptprd A G 4: 75,998,499 probably null Het
Rcn3 G T 7: 45,083,671 D258E probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sacs T A 14: 61,192,446 H651Q probably benign Het
Sacs T C 14: 61,211,253 S3583P probably damaging Het
Scel A G 14: 103,592,371 N463S possibly damaging Het
Serpinb2 A T 1: 107,515,554 I28F possibly damaging Het
Sin3b A G 8: 72,746,503 K484E probably benign Het
Snrnp48 T A 13: 38,216,421 V168D probably damaging Het
Snx18 T G 13: 113,618,395 M1L probably benign Het
Srcap T A 7: 127,559,032 N2693K unknown Het
Stim1 A G 7: 102,428,807 D172G Het
Stip1 A T 19: 7,025,319 L414H probably damaging Het
Sun1 A G 5: 139,223,635 H40R probably damaging Het
Sva T A 6: 42,042,248 D117E possibly damaging Het
Syne2 A G 12: 75,896,670 D321G probably damaging Het
Trim45 A G 3: 100,928,078 D459G probably damaging Het
Trove2 C T 1: 143,765,432 probably null Het
Ttc6 G A 12: 57,651,004 W43* probably null Het
Ugt2b35 A G 5: 87,004,921 T317A possibly damaging Het
Usp32 C T 11: 85,025,544 R858Q probably damaging Het
Vmn2r53 G T 7: 12,600,825 Q303K probably benign Het
Yeats2 T C 16: 20,150,562 probably null Het
Zfp804a A G 2: 82,258,403 N859D probably benign Het
Zscan10 A T 17: 23,605,606 Q12L possibly damaging Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0689:Myo9b UTSW 8 71330756 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2037:Myo9b UTSW 8 71290866 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2920:Myo9b UTSW 8 71325857 missense probably damaging 0.98
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R4736:Myo9b UTSW 8 71356592 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
R7957:Myo9b UTSW 8 71354761 missense probably benign 0.12
R8062:Myo9b UTSW 8 71321813 missense probably damaging 0.99
R8108:Myo9b UTSW 8 71348342 missense probably damaging 0.99
R8197:Myo9b UTSW 8 71290963 missense probably damaging 1.00
R8274:Myo9b UTSW 8 71359836 missense probably benign 0.00
R8686:Myo9b UTSW 8 71334322 missense probably benign 0.01
R8731:Myo9b UTSW 8 71353842 critical splice donor site probably null
R9056:Myo9b UTSW 8 71352262 missense probably benign 0.17
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71290709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAAAGCAGGCACAGGTTG -3'
(R):5'- CCTGCATAATGGATAGGCTTACTC -3'

Sequencing Primer
(F):5'- TAGACAGTAGGGTTAGCCC -3'
(R):5'- CATAATGGATAGGCTTACTCTGTGG -3'
Posted On2021-08-02