Incidental Mutation 'R8924:Myo9b'
ID 679474
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission 068769-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71725358-71813357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71801675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1277 (S1277G)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071935
AA Change: S1266G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: S1266G

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168839
AA Change: S1277G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: S1277G

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170242
AA Change: S1277G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: S1277G

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212935
AA Change: S1267G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,838,003 (GRCm39) V1145A probably benign Het
Ank1 T C 8: 23,589,011 (GRCm39) M562T probably benign Het
Atn1 A T 6: 124,722,211 (GRCm39) S881T probably benign Het
B3galt1 C T 2: 67,949,059 (GRCm39) T258I probably benign Het
Bahcc1 C T 11: 120,167,591 (GRCm39) L1331F probably benign Het
Capn12 G A 7: 28,582,628 (GRCm39) V168M probably damaging Het
Card14 T C 11: 119,216,930 (GRCm39) V338A possibly damaging Het
Cd27 T C 6: 125,213,432 (GRCm39) probably benign Het
Cd37 A G 7: 44,888,109 (GRCm39) L37P probably damaging Het
Cd96 A G 16: 45,919,385 (GRCm39) L212P probably damaging Het
Celsr1 T C 15: 85,916,671 (GRCm39) E434G possibly damaging Het
Cep152 A G 2: 125,444,778 (GRCm39) M456T possibly damaging Het
Ces3b G A 8: 105,811,619 (GRCm39) R45H probably benign Het
Cfap54 T G 10: 92,837,685 (GRCm39) T1072P probably damaging Het
Chodl A T 16: 78,738,659 (GRCm39) M172L possibly damaging Het
Cilp2 A G 8: 70,339,108 (GRCm39) S47P probably damaging Het
Clasrp T C 7: 19,318,232 (GRCm39) I596V unknown Het
Clcn2 C T 16: 20,530,930 (GRCm39) V267I probably damaging Het
Cntln T A 4: 84,806,936 (GRCm39) D139E probably damaging Het
Cyp2j12 A C 4: 95,994,685 (GRCm39) N379K probably damaging Het
Defb21 T C 2: 152,416,704 (GRCm39) V60A possibly damaging Het
Dnajc16 G T 4: 141,494,018 (GRCm39) S543* probably null Het
Efcab12 G T 6: 115,800,664 (GRCm39) H120N probably benign Het
Efcab3 AACTCTA AA 11: 104,806,253 (GRCm39) probably null Het
Efl1 G A 7: 82,412,161 (GRCm39) G850D probably benign Het
Efna1 T C 3: 89,183,635 (GRCm39) M64V probably benign Het
Eif2ak3 T C 6: 70,870,003 (GRCm39) W897R probably damaging Het
Eif2ak4 T A 2: 118,258,513 (GRCm39) F621Y probably damaging Het
Erbin C A 13: 103,975,966 (GRCm39) E643* probably null Het
Esr1 G A 10: 4,807,176 (GRCm39) W364* probably null Het
Fam171a2 T C 11: 102,330,861 (GRCm39) E206G possibly damaging Het
Fam90a1a T C 8: 22,451,429 (GRCm39) F97L probably benign Het
Fap A T 2: 62,378,165 (GRCm39) F181I probably benign Het
Fem1b T C 9: 62,704,916 (GRCm39) N115D probably damaging Het
Gal3st2b G T 1: 93,868,653 (GRCm39) A295S probably benign Het
Galnt10 G A 11: 57,674,681 (GRCm39) probably benign Het
Gcfc2 T C 6: 81,909,879 (GRCm39) V224A probably damaging Het
Gh T C 11: 106,191,634 (GRCm39) E136G probably damaging Het
Gjd3 C T 11: 98,873,325 (GRCm39) C173Y probably damaging Het
Gm12695 T A 4: 96,651,046 (GRCm39) M136L probably benign Het
Gnas A G 2: 174,141,277 (GRCm39) E482G unknown Het
Gpa33 T C 1: 165,980,351 (GRCm39) L138P probably damaging Het
Hlf T C 11: 90,236,714 (GRCm39) D181G probably damaging Het
Irgm1 A G 11: 48,756,698 (GRCm39) L387S probably benign Het
Kctd1 T C 18: 15,102,745 (GRCm39) E812G possibly damaging Het
Klra2 T C 6: 131,205,214 (GRCm39) E209G probably benign Het
Klra3 C T 6: 130,312,732 (GRCm39) V11M probably benign Het
Klrh1 G T 6: 129,745,084 (GRCm39) H171N probably benign Het
Kmt2c T C 5: 25,503,885 (GRCm39) S3808G probably benign Het
Krtap24-1 A C 16: 88,408,888 (GRCm39) S79R probably benign Het
Limch1 T A 5: 67,190,475 (GRCm39) H759Q probably benign Het
Map3k4 A G 17: 12,490,433 (GRCm39) Y333H probably benign Het
Mmel1 A G 4: 154,974,091 (GRCm39) Y377C probably damaging Het
Ms4a14 A T 19: 11,281,113 (GRCm39) Y482N possibly damaging Het
Nab1 T C 1: 52,529,667 (GRCm39) T77A possibly damaging Het
Obsl1 T C 1: 75,482,841 (GRCm39) S10G probably benign Het
Odc1 A G 12: 17,598,329 (GRCm39) T157A possibly damaging Het
Or2a5 T G 6: 42,873,964 (GRCm39) L193R probably damaging Het
Or8b52 T C 9: 38,576,780 (GRCm39) D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Plpp1 T A 13: 112,943,057 (GRCm39) probably benign Het
Prdm13 G A 4: 21,679,125 (GRCm39) A455V possibly damaging Het
Ptpn13 A T 5: 103,739,101 (GRCm39) Y2289F probably damaging Het
Ptpn18 G T 1: 34,498,966 (GRCm39) R21L probably benign Het
Ptprd A G 4: 75,916,736 (GRCm39) probably null Het
Rcn3 G T 7: 44,733,095 (GRCm39) D258E probably damaging Het
Ro60 C T 1: 143,641,170 (GRCm39) probably null Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Het
Sacs T A 14: 61,429,895 (GRCm39) H651Q probably benign Het
Sacs T C 14: 61,448,702 (GRCm39) S3583P probably damaging Het
Scel A G 14: 103,829,807 (GRCm39) N463S possibly damaging Het
Serpinb2 A T 1: 107,443,284 (GRCm39) I28F possibly damaging Het
Sin3b A G 8: 73,473,131 (GRCm39) K484E probably benign Het
Snrnp48 T A 13: 38,400,397 (GRCm39) V168D probably damaging Het
Snx18 T G 13: 113,754,931 (GRCm39) M1L probably benign Het
Spata31h1 T C 10: 82,131,295 (GRCm39) N572D probably benign Het
Srcap T A 7: 127,158,204 (GRCm39) N2693K unknown Het
Stim1 A G 7: 102,078,014 (GRCm39) D172G Het
Stip1 A T 19: 7,002,687 (GRCm39) L414H probably damaging Het
Sun1 A G 5: 139,209,390 (GRCm39) H40R probably damaging Het
Sva T A 6: 42,019,182 (GRCm39) D117E possibly damaging Het
Syne2 A G 12: 75,943,444 (GRCm39) D321G probably damaging Het
Trim45 A G 3: 100,835,394 (GRCm39) D459G probably damaging Het
Ttc6 G A 12: 57,697,790 (GRCm39) W43* probably null Het
Ugt2b35 A G 5: 87,152,780 (GRCm39) T317A possibly damaging Het
Usp32 C T 11: 84,916,370 (GRCm39) R858Q probably damaging Het
Vmn2r53 G T 7: 12,334,752 (GRCm39) Q303K probably benign Het
Yeats2 T C 16: 19,969,312 (GRCm39) probably null Het
Zfp804a A G 2: 82,088,747 (GRCm39) N859D probably benign Het
Zscan10 A T 17: 23,824,580 (GRCm39) Q12L possibly damaging Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71,801,379 (GRCm39) missense probably benign
IGL01020:Myo9b APN 8 71,804,644 (GRCm39) missense probably benign
IGL01479:Myo9b APN 8 71,811,986 (GRCm39) missense probably damaging 1.00
IGL01704:Myo9b APN 8 71,812,286 (GRCm39) missense probably damaging 0.98
IGL01761:Myo9b APN 8 71,801,796 (GRCm39) missense probably damaging 0.96
IGL01766:Myo9b APN 8 71,743,161 (GRCm39) missense probably damaging 1.00
IGL01834:Myo9b APN 8 71,807,901 (GRCm39) missense possibly damaging 0.93
IGL01834:Myo9b APN 8 71,808,962 (GRCm39) missense probably damaging 1.00
IGL01838:Myo9b APN 8 71,787,034 (GRCm39) missense probably damaging 0.99
IGL02318:Myo9b APN 8 71,806,768 (GRCm39) missense probably damaging 0.98
IGL02333:Myo9b APN 8 71,811,637 (GRCm39) missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71,743,689 (GRCm39) missense probably damaging 1.00
IGL02514:Myo9b APN 8 71,743,650 (GRCm39) missense probably damaging 1.00
IGL02593:Myo9b APN 8 71,743,417 (GRCm39) missense probably damaging 1.00
IGL03075:Myo9b APN 8 71,807,171 (GRCm39) missense probably damaging 1.00
IGL03332:Myo9b APN 8 71,801,418 (GRCm39) missense possibly damaging 0.78
avantgarde UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
Freaky UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
iconoclastic UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
unconventional UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71,775,591 (GRCm39) missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71,795,456 (GRCm39) missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71,786,412 (GRCm39) missense probably damaging 1.00
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0144:Myo9b UTSW 8 71,798,687 (GRCm39) missense probably damaging 1.00
R0207:Myo9b UTSW 8 71,807,869 (GRCm39) splice site probably benign
R0226:Myo9b UTSW 8 71,806,476 (GRCm39) missense probably damaging 1.00
R0227:Myo9b UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
R0244:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 1.00
R0277:Myo9b UTSW 8 71,808,596 (GRCm39) splice site probably benign
R0362:Myo9b UTSW 8 71,800,414 (GRCm39) missense probably damaging 1.00
R0689:Myo9b UTSW 8 71,783,400 (GRCm39) missense probably damaging 1.00
R0844:Myo9b UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
R1051:Myo9b UTSW 8 71,808,466 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1526:Myo9b UTSW 8 71,808,408 (GRCm39) missense probably damaging 1.00
R1544:Myo9b UTSW 8 71,743,620 (GRCm39) missense probably damaging 1.00
R1565:Myo9b UTSW 8 71,767,836 (GRCm39) missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71,775,622 (GRCm39) missense probably damaging 1.00
R1745:Myo9b UTSW 8 71,806,691 (GRCm39) missense probably damaging 1.00
R1820:Myo9b UTSW 8 71,786,002 (GRCm39) missense probably damaging 1.00
R2037:Myo9b UTSW 8 71,743,510 (GRCm39) missense probably damaging 1.00
R2050:Myo9b UTSW 8 71,743,194 (GRCm39) missense probably damaging 1.00
R2056:Myo9b UTSW 8 71,812,334 (GRCm39) missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71,786,343 (GRCm39) missense probably damaging 1.00
R2423:Myo9b UTSW 8 71,780,584 (GRCm39) missense probably damaging 1.00
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2873:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2874:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2920:Myo9b UTSW 8 71,778,501 (GRCm39) missense probably damaging 0.98
R2926:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2939:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2940:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3033:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3040:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3689:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3691:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3735:Myo9b UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
R4194:Myo9b UTSW 8 71,812,268 (GRCm39) missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71,808,409 (GRCm39) missense probably damaging 1.00
R4457:Myo9b UTSW 8 71,743,643 (GRCm39) missense probably damaging 1.00
R4478:Myo9b UTSW 8 71,743,725 (GRCm39) missense probably damaging 1.00
R4496:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R4544:Myo9b UTSW 8 71,780,585 (GRCm39) missense probably damaging 1.00
R4580:Myo9b UTSW 8 71,767,779 (GRCm39) missense probably damaging 1.00
R4736:Myo9b UTSW 8 71,809,236 (GRCm39) missense probably damaging 1.00
R5068:Myo9b UTSW 8 71,801,699 (GRCm39) missense probably damaging 1.00
R5124:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R5194:Myo9b UTSW 8 71,801,733 (GRCm39) missense probably benign 0.01
R5296:Myo9b UTSW 8 71,786,032 (GRCm39) missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71,775,918 (GRCm39) missense probably benign 0.06
R5664:Myo9b UTSW 8 71,812,526 (GRCm39) missense probably benign 0.13
R5677:Myo9b UTSW 8 71,796,330 (GRCm39) missense probably damaging 1.00
R5680:Myo9b UTSW 8 71,743,016 (GRCm39) missense probably benign 0.00
R5982:Myo9b UTSW 8 71,801,040 (GRCm39) missense probably benign 0.05
R6344:Myo9b UTSW 8 71,780,558 (GRCm39) missense probably damaging 1.00
R6352:Myo9b UTSW 8 71,801,055 (GRCm39) missense probably benign
R6352:Myo9b UTSW 8 71,801,054 (GRCm39) missense probably benign 0.16
R6411:Myo9b UTSW 8 71,775,599 (GRCm39) nonsense probably null
R6425:Myo9b UTSW 8 71,786,272 (GRCm39) missense probably damaging 1.00
R6505:Myo9b UTSW 8 71,808,501 (GRCm39) missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71,804,803 (GRCm39) splice site probably null
R6811:Myo9b UTSW 8 71,809,222 (GRCm39) missense probably damaging 1.00
R6813:Myo9b UTSW 8 71,775,949 (GRCm39) missense probably damaging 1.00
R6954:Myo9b UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
R7124:Myo9b UTSW 8 71,786,345 (GRCm39) nonsense probably null
R7255:Myo9b UTSW 8 71,743,535 (GRCm39) missense probably damaging 1.00
R7293:Myo9b UTSW 8 71,778,549 (GRCm39) missense probably benign 0.00
R7342:Myo9b UTSW 8 71,808,418 (GRCm39) missense probably damaging 1.00
R7451:Myo9b UTSW 8 71,804,832 (GRCm39) missense probably benign 0.28
R7482:Myo9b UTSW 8 71,795,442 (GRCm39) missense probably benign 0.00
R7508:Myo9b UTSW 8 71,807,445 (GRCm39) missense probably benign 0.00
R7957:Myo9b UTSW 8 71,807,405 (GRCm39) missense probably benign 0.12
R8062:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 0.99
R8108:Myo9b UTSW 8 71,800,986 (GRCm39) missense probably damaging 0.99
R8197:Myo9b UTSW 8 71,743,607 (GRCm39) missense probably damaging 1.00
R8274:Myo9b UTSW 8 71,812,480 (GRCm39) missense probably benign 0.00
R8686:Myo9b UTSW 8 71,786,966 (GRCm39) missense probably benign 0.01
R8731:Myo9b UTSW 8 71,806,486 (GRCm39) critical splice donor site probably null
R9056:Myo9b UTSW 8 71,804,906 (GRCm39) missense probably benign 0.17
R9117:Myo9b UTSW 8 71,800,451 (GRCm39) missense probably benign 0.03
R9151:Myo9b UTSW 8 71,807,871 (GRCm39) splice site probably benign
R9315:Myo9b UTSW 8 71,801,811 (GRCm39) missense possibly damaging 0.54
R9332:Myo9b UTSW 8 71,812,246 (GRCm39) missense probably benign 0.07
R9364:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R9569:Myo9b UTSW 8 71,811,629 (GRCm39) missense probably benign
R9581:Myo9b UTSW 8 71,812,543 (GRCm39) missense probably benign 0.19
R9600:Myo9b UTSW 8 71,743,075 (GRCm39) missense possibly damaging 0.80
X0066:Myo9b UTSW 8 71,776,542 (GRCm39) missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71,743,353 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAAAGCAGGCACAGGTTG -3'
(R):5'- CCTGCATAATGGATAGGCTTACTC -3'

Sequencing Primer
(F):5'- TAGACAGTAGGGTTAGCCC -3'
(R):5'- CATAATGGATAGGCTTACTCTGTGG -3'
Posted On 2021-08-02