Incidental Mutation 'R8924:Cfap54'
ID 679481
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 92775619-93081618 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 93001823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 1072 (T1072P)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000168110
AA Change: T1072P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: T1072P

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170065
Predicted Effect probably damaging
Transcript: ENSMUST00000212902
AA Change: T1072P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,295,461 N572D probably benign Het
Abca8b A G 11: 109,947,177 V1145A probably benign Het
Ank1 T C 8: 23,098,995 M562T probably benign Het
Atn1 A T 6: 124,745,248 S881T probably benign Het
B3galt1 C T 2: 68,118,715 T258I probably benign Het
Bahcc1 C T 11: 120,276,765 L1331F probably benign Het
Capn12 G A 7: 28,883,203 V168M probably damaging Het
Card14 T C 11: 119,326,104 V338A possibly damaging Het
Cd27 T C 6: 125,236,469 probably benign Het
Cd37 A G 7: 45,238,685 L37P probably damaging Het
Cd96 A G 16: 46,099,022 L212P probably damaging Het
Celsr1 T C 15: 86,032,470 E434G possibly damaging Het
Cep152 A G 2: 125,602,858 M456T possibly damaging Het
Ces3b G A 8: 105,084,987 R45H probably benign Het
Chodl A T 16: 78,941,771 M172L possibly damaging Het
Cilp2 A G 8: 69,886,458 S47P probably damaging Het
Clasrp T C 7: 19,584,307 I596V unknown Het
Clcn2 C T 16: 20,712,180 V267I probably damaging Het
Cntln T A 4: 84,888,699 D139E probably damaging Het
Cyp2j12 A C 4: 96,106,448 N379K probably damaging Het
Defb21 T C 2: 152,574,784 V60A possibly damaging Het
Dnajc16 G T 4: 141,766,707 S543* probably null Het
Efcab12 G T 6: 115,823,703 H120N probably benign Het
Efl1 G A 7: 82,762,953 G850D probably benign Het
Efna1 T C 3: 89,276,328 M64V probably benign Het
Eif2ak3 T C 6: 70,893,019 W897R probably damaging Het
Eif2ak4 T A 2: 118,428,032 F621Y probably damaging Het
Erbin C A 13: 103,839,458 E643* probably null Het
Esr1 G A 10: 4,857,176 W364* probably null Het
Fam171a2 T C 11: 102,440,035 E206G possibly damaging Het
Fam90a1a T C 8: 21,961,413 F97L probably benign Het
Fap A T 2: 62,547,821 F181I probably benign Het
Fem1b T C 9: 62,797,634 N115D probably damaging Het
Gal3st2b G T 1: 93,940,931 A295S probably benign Het
Galnt10 G A 11: 57,783,855 probably benign Het
Gcfc2 T C 6: 81,932,898 V224A probably damaging Het
Gh T C 11: 106,300,808 E136G probably damaging Het
Gjd3 C T 11: 98,982,499 C173Y probably damaging Het
Gm11639 AACTCTA AA 11: 104,915,427 probably null Het
Gm12695 T A 4: 96,762,809 M136L probably benign Het
Gm156 G T 6: 129,768,121 H171N probably benign Het
Gnas A G 2: 174,299,484 E482G unknown Het
Gpa33 T C 1: 166,152,782 L138P probably damaging Het
Hlf T C 11: 90,345,888 D181G probably damaging Het
Irgm1 A G 11: 48,865,871 L387S probably benign Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Klra2 T C 6: 131,228,251 E209G probably benign Het
Klra3 C T 6: 130,335,769 V11M probably benign Het
Kmt2c T C 5: 25,298,887 S3808G probably benign Het
Krtap24-1 A C 16: 88,612,000 S79R probably benign Het
Limch1 T A 5: 67,033,132 H759Q probably benign Het
Map3k4 A G 17: 12,271,546 Y333H probably benign Het
Mmel1 A G 4: 154,889,634 Y377C probably damaging Het
Ms4a14 A T 19: 11,303,749 Y482N possibly damaging Het
Myo9b A G 8: 71,349,031 S1277G probably benign Het
Nab1 T C 1: 52,490,508 T77A possibly damaging Het
Obsl1 T C 1: 75,506,197 S10G probably benign Het
Odc1 A G 12: 17,548,328 T157A possibly damaging Het
Olfr448 T G 6: 42,897,030 L193R probably damaging Het
Olfr917 T C 9: 38,665,484 D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plpp1 T A 13: 112,806,523 probably benign Het
Prdm13 G A 4: 21,679,125 A455V possibly damaging Het
Ptpn13 A T 5: 103,591,235 Y2289F probably damaging Het
Ptpn18 G T 1: 34,459,885 R21L probably benign Het
Ptprd A G 4: 75,998,499 probably null Het
Rcn3 G T 7: 45,083,671 D258E probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sacs T A 14: 61,192,446 H651Q probably benign Het
Sacs T C 14: 61,211,253 S3583P probably damaging Het
Scel A G 14: 103,592,371 N463S possibly damaging Het
Serpinb2 A T 1: 107,515,554 I28F possibly damaging Het
Sin3b A G 8: 72,746,503 K484E probably benign Het
Snrnp48 T A 13: 38,216,421 V168D probably damaging Het
Snx18 T G 13: 113,618,395 M1L probably benign Het
Srcap T A 7: 127,559,032 N2693K unknown Het
Stim1 A G 7: 102,428,807 D172G Het
Stip1 A T 19: 7,025,319 L414H probably damaging Het
Sun1 A G 5: 139,223,635 H40R probably damaging Het
Sva T A 6: 42,042,248 D117E possibly damaging Het
Syne2 A G 12: 75,896,670 D321G probably damaging Het
Trim45 A G 3: 100,928,078 D459G probably damaging Het
Trove2 C T 1: 143,765,432 probably null Het
Ttc6 G A 12: 57,651,004 W43* probably null Het
Ugt2b35 A G 5: 87,004,921 T317A possibly damaging Het
Usp32 C T 11: 85,025,544 R858Q probably damaging Het
Vmn2r53 G T 7: 12,600,825 Q303K probably benign Het
Yeats2 T C 16: 20,150,562 probably null Het
Zfp804a A G 2: 82,258,403 N859D probably benign Het
Zscan10 A T 17: 23,605,606 Q12L possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 splice site probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7844:Cfap54 UTSW 10 92902058 missense unknown
R7980:Cfap54 UTSW 10 92982060 missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92902079 missense unknown
R8101:Cfap54 UTSW 10 92884796 missense unknown
R8119:Cfap54 UTSW 10 92868810 missense unknown
R8134:Cfap54 UTSW 10 92878516 missense unknown
R8168:Cfap54 UTSW 10 92908877 missense unknown
R8179:Cfap54 UTSW 10 92997316 missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92962417 missense unknown
R8436:Cfap54 UTSW 10 92964536 missense unknown
R8505:Cfap54 UTSW 10 92978993 missense probably benign 0.03
R8671:Cfap54 UTSW 10 92955072 missense unknown
R8716:Cfap54 UTSW 10 92964632 missense probably benign 0.00
R8816:Cfap54 UTSW 10 92878592 missense unknown
R8822:Cfap54 UTSW 10 93039141 missense probably benign 0.09
R8827:Cfap54 UTSW 10 92938248 missense unknown
R8920:Cfap54 UTSW 10 92940337 critical splice acceptor site probably null
R8954:Cfap54 UTSW 10 93043393 missense probably damaging 1.00
R8963:Cfap54 UTSW 10 93028700 nonsense probably null
R9010:Cfap54 UTSW 10 92899059 missense unknown
R9017:Cfap54 UTSW 10 92816021 missense probably benign 0.07
R9093:Cfap54 UTSW 10 92815908 missense probably benign 0.03
R9095:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92984235 missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92994717 missense probably benign 0.10
R9196:Cfap54 UTSW 10 93037891 missense probably benign 0.22
R9203:Cfap54 UTSW 10 93045128 missense probably benign 0.30
R9258:Cfap54 UTSW 10 92935098 missense unknown
R9275:Cfap54 UTSW 10 93039186 missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92969703 missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92821074 missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92962315 missense unknown
R9397:Cfap54 UTSW 10 92997285 missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92902058 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGAGTACCCATGTTTCTGC -3'
(R):5'- CTGAGTGAAAAGGTCCCTGAG -3'

Sequencing Primer
(F):5'- ACCACTTGAATTTGTATCCCGAAGC -3'
(R):5'- CCCTGAGACAATGTGGTTTTTG -3'
Posted On 2021-08-02