Incidental Mutation 'R8924:Scel'
ID 679500
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103592371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 463 (N463S)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000095576
AA Change: N463S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: N463S

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227322
AA Change: N443S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,295,461 N572D probably benign Het
Abca8b A G 11: 109,947,177 V1145A probably benign Het
Ank1 T C 8: 23,098,995 M562T probably benign Het
Atn1 A T 6: 124,745,248 S881T probably benign Het
B3galt1 C T 2: 68,118,715 T258I probably benign Het
Bahcc1 C T 11: 120,276,765 L1331F probably benign Het
Capn12 G A 7: 28,883,203 V168M probably damaging Het
Card14 T C 11: 119,326,104 V338A possibly damaging Het
Cd27 T C 6: 125,236,469 probably benign Het
Cd37 A G 7: 45,238,685 L37P probably damaging Het
Cd96 A G 16: 46,099,022 L212P probably damaging Het
Celsr1 T C 15: 86,032,470 E434G possibly damaging Het
Cep152 A G 2: 125,602,858 M456T possibly damaging Het
Ces3b G A 8: 105,084,987 R45H probably benign Het
Cfap54 T G 10: 93,001,823 T1072P probably damaging Het
Chodl A T 16: 78,941,771 M172L possibly damaging Het
Cilp2 A G 8: 69,886,458 S47P probably damaging Het
Clasrp T C 7: 19,584,307 I596V unknown Het
Clcn2 C T 16: 20,712,180 V267I probably damaging Het
Cntln T A 4: 84,888,699 D139E probably damaging Het
Cyp2j12 A C 4: 96,106,448 N379K probably damaging Het
Defb21 T C 2: 152,574,784 V60A possibly damaging Het
Dnajc16 G T 4: 141,766,707 S543* probably null Het
Efcab12 G T 6: 115,823,703 H120N probably benign Het
Efl1 G A 7: 82,762,953 G850D probably benign Het
Efna1 T C 3: 89,276,328 M64V probably benign Het
Eif2ak3 T C 6: 70,893,019 W897R probably damaging Het
Eif2ak4 T A 2: 118,428,032 F621Y probably damaging Het
Erbin C A 13: 103,839,458 E643* probably null Het
Esr1 G A 10: 4,857,176 W364* probably null Het
Fam171a2 T C 11: 102,440,035 E206G possibly damaging Het
Fam90a1a T C 8: 21,961,413 F97L probably benign Het
Fap A T 2: 62,547,821 F181I probably benign Het
Fem1b T C 9: 62,797,634 N115D probably damaging Het
Gal3st2b G T 1: 93,940,931 A295S probably benign Het
Galnt10 G A 11: 57,783,855 probably benign Het
Gcfc2 T C 6: 81,932,898 V224A probably damaging Het
Gh T C 11: 106,300,808 E136G probably damaging Het
Gjd3 C T 11: 98,982,499 C173Y probably damaging Het
Gm11639 AACTCTA AA 11: 104,915,427 probably null Het
Gm12695 T A 4: 96,762,809 M136L probably benign Het
Gm156 G T 6: 129,768,121 H171N probably benign Het
Gnas A G 2: 174,299,484 E482G unknown Het
Gpa33 T C 1: 166,152,782 L138P probably damaging Het
Hlf T C 11: 90,345,888 D181G probably damaging Het
Irgm1 A G 11: 48,865,871 L387S probably benign Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Klra2 T C 6: 131,228,251 E209G probably benign Het
Klra3 C T 6: 130,335,769 V11M probably benign Het
Kmt2c T C 5: 25,298,887 S3808G probably benign Het
Krtap24-1 A C 16: 88,612,000 S79R probably benign Het
Limch1 T A 5: 67,033,132 H759Q probably benign Het
Map3k4 A G 17: 12,271,546 Y333H probably benign Het
Mmel1 A G 4: 154,889,634 Y377C probably damaging Het
Ms4a14 A T 19: 11,303,749 Y482N possibly damaging Het
Myo9b A G 8: 71,349,031 S1277G probably benign Het
Nab1 T C 1: 52,490,508 T77A possibly damaging Het
Obsl1 T C 1: 75,506,197 S10G probably benign Het
Odc1 A G 12: 17,548,328 T157A possibly damaging Het
Olfr448 T G 6: 42,897,030 L193R probably damaging Het
Olfr917 T C 9: 38,665,484 D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plpp1 T A 13: 112,806,523 probably benign Het
Prdm13 G A 4: 21,679,125 A455V possibly damaging Het
Ptpn13 A T 5: 103,591,235 Y2289F probably damaging Het
Ptpn18 G T 1: 34,459,885 R21L probably benign Het
Ptprd A G 4: 75,998,499 probably null Het
Rcn3 G T 7: 45,083,671 D258E probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sacs T A 14: 61,192,446 H651Q probably benign Het
Sacs T C 14: 61,211,253 S3583P probably damaging Het
Serpinb2 A T 1: 107,515,554 I28F possibly damaging Het
Sin3b A G 8: 72,746,503 K484E probably benign Het
Snrnp48 T A 13: 38,216,421 V168D probably damaging Het
Snx18 T G 13: 113,618,395 M1L probably benign Het
Srcap T A 7: 127,559,032 N2693K unknown Het
Stim1 A G 7: 102,428,807 D172G Het
Stip1 A T 19: 7,025,319 L414H probably damaging Het
Sun1 A G 5: 139,223,635 H40R probably damaging Het
Sva T A 6: 42,042,248 D117E possibly damaging Het
Syne2 A G 12: 75,896,670 D321G probably damaging Het
Trim45 A G 3: 100,928,078 D459G probably damaging Het
Trove2 C T 1: 143,765,432 probably null Het
Ttc6 G A 12: 57,651,004 W43* probably null Het
Ugt2b35 A G 5: 87,004,921 T317A possibly damaging Het
Usp32 C T 11: 85,025,544 R858Q probably damaging Het
Vmn2r53 G T 7: 12,600,825 Q303K probably benign Het
Yeats2 T C 16: 20,150,562 probably null Het
Zfp804a A G 2: 82,258,403 N859D probably benign Het
Zscan10 A T 17: 23,605,606 Q12L possibly damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGTAGACAGCACCATCAGAGG -3'
(R):5'- AGTTCAGGAAGAGTACAGTATGTCTC -3'

Sequencing Primer
(F):5'- CCATCAGAGGGAATCCTACAGG -3'
(R):5'- AGAGTACAGTATGTCTCCTTGTTGAC -3'
Posted On 2021-08-02