Incidental Mutation 'R8924:Clcn2'
ID 679503
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms nmf240, Clc2, ClC-2
MMRRC Submission 068769-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20521714-20536496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20530930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 267 (V267I)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect probably damaging
Transcript: ENSMUST00000007207
AA Change: V267I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: V267I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: V267I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: V267I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131522
AA Change: V267I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843
AA Change: V267I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000232309
AA Change: V223I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,838,003 (GRCm39) V1145A probably benign Het
Ank1 T C 8: 23,589,011 (GRCm39) M562T probably benign Het
Atn1 A T 6: 124,722,211 (GRCm39) S881T probably benign Het
B3galt1 C T 2: 67,949,059 (GRCm39) T258I probably benign Het
Bahcc1 C T 11: 120,167,591 (GRCm39) L1331F probably benign Het
Capn12 G A 7: 28,582,628 (GRCm39) V168M probably damaging Het
Card14 T C 11: 119,216,930 (GRCm39) V338A possibly damaging Het
Cd27 T C 6: 125,213,432 (GRCm39) probably benign Het
Cd37 A G 7: 44,888,109 (GRCm39) L37P probably damaging Het
Cd96 A G 16: 45,919,385 (GRCm39) L212P probably damaging Het
Celsr1 T C 15: 85,916,671 (GRCm39) E434G possibly damaging Het
Cep152 A G 2: 125,444,778 (GRCm39) M456T possibly damaging Het
Ces3b G A 8: 105,811,619 (GRCm39) R45H probably benign Het
Cfap54 T G 10: 92,837,685 (GRCm39) T1072P probably damaging Het
Chodl A T 16: 78,738,659 (GRCm39) M172L possibly damaging Het
Cilp2 A G 8: 70,339,108 (GRCm39) S47P probably damaging Het
Clasrp T C 7: 19,318,232 (GRCm39) I596V unknown Het
Cntln T A 4: 84,806,936 (GRCm39) D139E probably damaging Het
Cyp2j12 A C 4: 95,994,685 (GRCm39) N379K probably damaging Het
Defb21 T C 2: 152,416,704 (GRCm39) V60A possibly damaging Het
Dnajc16 G T 4: 141,494,018 (GRCm39) S543* probably null Het
Efcab12 G T 6: 115,800,664 (GRCm39) H120N probably benign Het
Efcab3 AACTCTA AA 11: 104,806,253 (GRCm39) probably null Het
Efl1 G A 7: 82,412,161 (GRCm39) G850D probably benign Het
Efna1 T C 3: 89,183,635 (GRCm39) M64V probably benign Het
Eif2ak3 T C 6: 70,870,003 (GRCm39) W897R probably damaging Het
Eif2ak4 T A 2: 118,258,513 (GRCm39) F621Y probably damaging Het
Erbin C A 13: 103,975,966 (GRCm39) E643* probably null Het
Esr1 G A 10: 4,807,176 (GRCm39) W364* probably null Het
Fam171a2 T C 11: 102,330,861 (GRCm39) E206G possibly damaging Het
Fam90a1a T C 8: 22,451,429 (GRCm39) F97L probably benign Het
Fap A T 2: 62,378,165 (GRCm39) F181I probably benign Het
Fem1b T C 9: 62,704,916 (GRCm39) N115D probably damaging Het
Gal3st2b G T 1: 93,868,653 (GRCm39) A295S probably benign Het
Galnt10 G A 11: 57,674,681 (GRCm39) probably benign Het
Gcfc2 T C 6: 81,909,879 (GRCm39) V224A probably damaging Het
Gh T C 11: 106,191,634 (GRCm39) E136G probably damaging Het
Gjd3 C T 11: 98,873,325 (GRCm39) C173Y probably damaging Het
Gm12695 T A 4: 96,651,046 (GRCm39) M136L probably benign Het
Gnas A G 2: 174,141,277 (GRCm39) E482G unknown Het
Gpa33 T C 1: 165,980,351 (GRCm39) L138P probably damaging Het
Hlf T C 11: 90,236,714 (GRCm39) D181G probably damaging Het
Irgm1 A G 11: 48,756,698 (GRCm39) L387S probably benign Het
Kctd1 T C 18: 15,102,745 (GRCm39) E812G possibly damaging Het
Klra2 T C 6: 131,205,214 (GRCm39) E209G probably benign Het
Klra3 C T 6: 130,312,732 (GRCm39) V11M probably benign Het
Klrh1 G T 6: 129,745,084 (GRCm39) H171N probably benign Het
Kmt2c T C 5: 25,503,885 (GRCm39) S3808G probably benign Het
Krtap24-1 A C 16: 88,408,888 (GRCm39) S79R probably benign Het
Limch1 T A 5: 67,190,475 (GRCm39) H759Q probably benign Het
Map3k4 A G 17: 12,490,433 (GRCm39) Y333H probably benign Het
Mmel1 A G 4: 154,974,091 (GRCm39) Y377C probably damaging Het
Ms4a14 A T 19: 11,281,113 (GRCm39) Y482N possibly damaging Het
Myo9b A G 8: 71,801,675 (GRCm39) S1277G probably benign Het
Nab1 T C 1: 52,529,667 (GRCm39) T77A possibly damaging Het
Obsl1 T C 1: 75,482,841 (GRCm39) S10G probably benign Het
Odc1 A G 12: 17,598,329 (GRCm39) T157A possibly damaging Het
Or2a5 T G 6: 42,873,964 (GRCm39) L193R probably damaging Het
Or8b52 T C 9: 38,576,780 (GRCm39) D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Plpp1 T A 13: 112,943,057 (GRCm39) probably benign Het
Prdm13 G A 4: 21,679,125 (GRCm39) A455V possibly damaging Het
Ptpn13 A T 5: 103,739,101 (GRCm39) Y2289F probably damaging Het
Ptpn18 G T 1: 34,498,966 (GRCm39) R21L probably benign Het
Ptprd A G 4: 75,916,736 (GRCm39) probably null Het
Rcn3 G T 7: 44,733,095 (GRCm39) D258E probably damaging Het
Ro60 C T 1: 143,641,170 (GRCm39) probably null Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Het
Sacs T A 14: 61,429,895 (GRCm39) H651Q probably benign Het
Sacs T C 14: 61,448,702 (GRCm39) S3583P probably damaging Het
Scel A G 14: 103,829,807 (GRCm39) N463S possibly damaging Het
Serpinb2 A T 1: 107,443,284 (GRCm39) I28F possibly damaging Het
Sin3b A G 8: 73,473,131 (GRCm39) K484E probably benign Het
Snrnp48 T A 13: 38,400,397 (GRCm39) V168D probably damaging Het
Snx18 T G 13: 113,754,931 (GRCm39) M1L probably benign Het
Spata31h1 T C 10: 82,131,295 (GRCm39) N572D probably benign Het
Srcap T A 7: 127,158,204 (GRCm39) N2693K unknown Het
Stim1 A G 7: 102,078,014 (GRCm39) D172G Het
Stip1 A T 19: 7,002,687 (GRCm39) L414H probably damaging Het
Sun1 A G 5: 139,209,390 (GRCm39) H40R probably damaging Het
Sva T A 6: 42,019,182 (GRCm39) D117E possibly damaging Het
Syne2 A G 12: 75,943,444 (GRCm39) D321G probably damaging Het
Trim45 A G 3: 100,835,394 (GRCm39) D459G probably damaging Het
Ttc6 G A 12: 57,697,790 (GRCm39) W43* probably null Het
Ugt2b35 A G 5: 87,152,780 (GRCm39) T317A possibly damaging Het
Usp32 C T 11: 84,916,370 (GRCm39) R858Q probably damaging Het
Vmn2r53 G T 7: 12,334,752 (GRCm39) Q303K probably benign Het
Yeats2 T C 16: 19,969,312 (GRCm39) probably null Het
Zfp804a A G 2: 82,088,747 (GRCm39) N859D probably benign Het
Zscan10 A T 17: 23,824,580 (GRCm39) Q12L possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20,522,391 (GRCm39) missense probably benign 0.08
IGL01657:Clcn2 APN 16 20,532,369 (GRCm39) missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20,531,511 (GRCm39) missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20,527,214 (GRCm39) missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20,522,098 (GRCm39) missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20,528,006 (GRCm39) nonsense probably null
IGL03329:Clcn2 APN 16 20,530,902 (GRCm39) missense probably damaging 1.00
Bemr14 UTSW 16 0 () unclassified
R0008:Clcn2 UTSW 16 20,529,140 (GRCm39) missense probably null 1.00
R0454:Clcn2 UTSW 16 20,529,178 (GRCm39) critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20,522,345 (GRCm39) missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20,531,302 (GRCm39) splice site probably benign
R1824:Clcn2 UTSW 16 20,534,712 (GRCm39) missense probably benign 0.04
R4592:Clcn2 UTSW 16 20,527,892 (GRCm39) missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20,522,053 (GRCm39) missense probably benign 0.01
R5374:Clcn2 UTSW 16 20,528,419 (GRCm39) missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20,529,285 (GRCm39) intron probably benign
R5787:Clcn2 UTSW 16 20,522,183 (GRCm39) missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20,532,404 (GRCm39) missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20,530,438 (GRCm39) critical splice donor site probably null
R6663:Clcn2 UTSW 16 20,521,995 (GRCm39) makesense probably null
R6765:Clcn2 UTSW 16 20,526,418 (GRCm39) splice site probably null
R6825:Clcn2 UTSW 16 20,528,408 (GRCm39) utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20,527,210 (GRCm39) missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20,527,512 (GRCm39) missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20,525,946 (GRCm39) missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20,532,168 (GRCm39) missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20,531,080 (GRCm39) missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20,531,414 (GRCm39) missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20,525,979 (GRCm39) missense probably benign 0.00
R9456:Clcn2 UTSW 16 20,534,702 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCTGTGATGGTTTCTAACG -3'
(R):5'- AGATGCTAGCTGCTGCATGC -3'

Sequencing Primer
(F):5'- GCAGGTCTAACTGTGTCCC -3'
(R):5'- TGCATGCGCAGTAGGAGTG -3'
Posted On 2021-08-02