Incidental Mutation 'R8926:Intu'
ID679525
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8926 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40653709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
Predicted Effect probably damaging
Transcript: ENSMUST00000061590
AA Change: D32E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: D32E

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000091186
AA Change: D50E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,444 C1611Y probably damaging Het
Adgrf3 T A 5: 30,200,448 D296V possibly damaging Het
Ahi1 T C 10: 21,055,083 Y941H probably damaging Het
Bscl2 T C 19: 8,847,984 probably null Het
C1s1 C T 6: 124,533,366 G374D probably damaging Het
C1s1 T C 6: 124,536,363 D235G possibly damaging Het
Cacna1e C T 1: 154,701,334 V106I possibly damaging Het
Ccdc97 G A 7: 25,713,069 A316V probably benign Het
Ces1a A G 8: 93,025,213 V431A probably benign Het
Cftr C T 6: 18,268,004 S684L possibly damaging Het
Cgnl1 T A 9: 71,725,253 N272I probably benign Het
Csf2rb C T 15: 78,340,549 S169L probably benign Het
Cyp11b1 T A 15: 74,839,238 Y197F probably benign Het
Cyp1a2 T C 9: 57,681,078 K288E probably benign Het
Dapk1 T A 13: 60,760,920 W1116R probably damaging Het
Dclre1c A T 2: 3,433,790 D97V probably damaging Het
Efcc1 A G 6: 87,749,187 R323G probably benign Het
Epha6 T A 16: 59,839,299 I819F probably benign Het
Fam118b A T 9: 35,235,436 L45Q probably damaging Het
Fsd1l T G 4: 53,686,493 I302S probably benign Het
Fsip2 T A 2: 82,993,583 D6553E possibly damaging Het
Gje1 C T 10: 14,716,691 V116I probably benign Het
Gm7030 T A 17: 36,109,734 probably null Het
Helz C A 11: 107,672,683 H1650N unknown Het
Hltf T G 3: 20,069,159 probably null Het
Lama5 G A 2: 180,193,990 T1217I probably benign Het
Lct T A 1: 128,300,411 Y1115F probably damaging Het
Lpgat1 T C 1: 191,760,008 L202P probably damaging Het
Lrp1 C T 10: 127,545,802 R3801H probably benign Het
Mtfmt T A 9: 65,437,132 Y113* probably null Het
Myh7 A G 14: 54,985,076 F801L probably benign Het
Myl4 G T 11: 104,585,746 M191I probably benign Het
Myo3a C A 2: 22,396,263 N614K possibly damaging Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nol10 C A 12: 17,416,870 Q584K probably benign Het
Nup210 C A 6: 91,053,452 G919C probably damaging Het
Olfr480 G A 7: 108,066,306 T134I probably benign Het
Olfr53 G A 7: 140,652,200 V74M probably benign Het
Pdcd6ip T A 9: 113,685,425 Q244L probably benign Het
Pde4d T C 13: 109,938,091 V410A probably benign Het
Plpp4 A T 7: 129,321,487 probably null Het
Poln T C 5: 34,129,425 N133S probably benign Het
Ppfibp1 A G 6: 147,019,488 N575D probably damaging Het
Prex2 T A 1: 11,089,706 probably null Het
Prkar2b A G 12: 32,061,081 M1T probably null Het
Ptcd3 A G 6: 71,892,480 F378S probably damaging Het
Rab27b C A 18: 69,996,073 R50L probably damaging Het
Rpl7a T G 2: 26,911,545 F83C probably damaging Het
Slc8a2 A G 7: 16,134,269 E142G probably damaging Het
Slc9a4 A T 1: 40,580,768 I85L possibly damaging Het
Sorcs1 C A 19: 50,252,658 W430L possibly damaging Het
Spaca6 T A 17: 17,838,528 probably null Het
Synrg C A 11: 83,990,741 A301E possibly damaging Het
Tecpr1 C T 5: 144,216,962 V158M probably damaging Het
Tex2 T G 11: 106,568,404 T67P Het
Tlr9 A T 9: 106,226,014 I835L probably benign Het
Tmem185b G C 1: 119,526,676 V56L probably benign Het
Tssk2 C T 16: 17,899,698 R322W probably benign Het
Ttn T A 2: 76,741,391 Y26386F probably benign Het
Txndc16 C A 14: 45,169,314 R228I possibly damaging Het
Uspl1 T G 5: 149,201,891 probably null Het
Vmn1r113 A T 7: 20,787,949 H222L possibly damaging Het
Vnn1 T G 10: 23,900,689 S313A probably benign Het
Zc3hc1 A T 6: 30,374,888 L218Q possibly damaging Het
Znrf1 T G 8: 111,537,511 L124R probably damaging Het
Zzz3 A T 3: 152,427,892 N196Y possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGCATCTTCCCAGCCTCTG -3'
(R):5'- TGGAATCGTCCTCTTCGATG -3'

Sequencing Primer
(F):5'- GTACCCTGGAACTCACTGTGTAG -3'
(R):5'- GGAATCGTCCTCTTCGATGATGAC -3'
Posted On2021-08-02