Incidental Mutation 'R8926:Intu'
ID 679525
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
MMRRC Submission 068770-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8926 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40608139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably damaging
Transcript: ENSMUST00000061590
AA Change: D32E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: D32E

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000091186
AA Change: D50E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,405,446 (GRCm39) D296V possibly damaging Het
Ahi1 T C 10: 20,930,982 (GRCm39) Y941H probably damaging Het
Bscl2 T C 19: 8,825,348 (GRCm39) probably null Het
C1s1 C T 6: 124,510,325 (GRCm39) G374D probably damaging Het
C1s1 T C 6: 124,513,322 (GRCm39) D235G possibly damaging Het
Cacna1e C T 1: 154,577,080 (GRCm39) V106I possibly damaging Het
Ccdc97 G A 7: 25,412,494 (GRCm39) A316V probably benign Het
Ces1a A G 8: 93,751,841 (GRCm39) V431A probably benign Het
Cftr C T 6: 18,268,003 (GRCm39) S684L possibly damaging Het
Cgnl1 T A 9: 71,632,535 (GRCm39) N272I probably benign Het
Csf2rb C T 15: 78,224,749 (GRCm39) S169L probably benign Het
Cux1 T A 5: 136,338,404 (GRCm39) probably benign Het
Cyp11b1 T A 15: 74,711,087 (GRCm39) Y197F probably benign Het
Cyp1a2 T C 9: 57,588,361 (GRCm39) K288E probably benign Het
Dapk1 T A 13: 60,908,734 (GRCm39) W1116R probably damaging Het
Dclre1c A T 2: 3,434,827 (GRCm39) D97V probably damaging Het
Efcc1 A G 6: 87,726,169 (GRCm39) R323G probably benign Het
Epha6 T A 16: 59,659,662 (GRCm39) I819F probably benign Het
Fam118b A T 9: 35,146,732 (GRCm39) L45Q probably damaging Het
Fcgbpl1 G A 7: 27,853,869 (GRCm39) C1611Y probably damaging Het
Fsd1l T G 4: 53,686,493 (GRCm39) I302S probably benign Het
Fsip2 T A 2: 82,823,927 (GRCm39) D6553E possibly damaging Het
Gje1 C T 10: 14,592,435 (GRCm39) V116I probably benign Het
H2-T9 T A 17: 36,420,626 (GRCm39) probably null Het
Helz C A 11: 107,563,509 (GRCm39) H1650N unknown Het
Hltf T G 3: 20,123,323 (GRCm39) probably null Het
Ipo9 C T 1: 135,313,952 (GRCm39) probably benign Het
Lama5 G A 2: 179,835,783 (GRCm39) T1217I probably benign Het
Lct T A 1: 128,228,148 (GRCm39) Y1115F probably damaging Het
Lpgat1 T C 1: 191,492,120 (GRCm39) L202P probably damaging Het
Lrp1 C T 10: 127,381,671 (GRCm39) R3801H probably benign Het
Mtfmt T A 9: 65,344,414 (GRCm39) Y113* probably null Het
Myh7 A G 14: 55,222,533 (GRCm39) F801L probably benign Het
Myl4 G T 11: 104,476,572 (GRCm39) M191I probably benign Het
Myo3a C A 2: 22,401,074 (GRCm39) N614K possibly damaging Het
Naa30 A G 14: 49,425,059 (GRCm39) N337S probably benign Het
Nol10 C A 12: 17,466,871 (GRCm39) Q584K probably benign Het
Nup210 C A 6: 91,030,434 (GRCm39) G919C probably damaging Het
Or13a20 G A 7: 140,232,113 (GRCm39) V74M probably benign Het
Or5p57 G A 7: 107,665,513 (GRCm39) T134I probably benign Het
Pdcd6ip T A 9: 113,514,493 (GRCm39) Q244L probably benign Het
Pde4d T C 13: 110,074,625 (GRCm39) V410A probably benign Het
Plekha7 A T 7: 115,756,223 (GRCm39) probably benign Het
Plpp4 A T 7: 128,923,211 (GRCm39) probably null Het
Poln T C 5: 34,286,769 (GRCm39) N133S probably benign Het
Ppfibp1 A G 6: 146,920,986 (GRCm39) N575D probably damaging Het
Prex2 T A 1: 11,159,930 (GRCm39) probably null Het
Prkar2b A G 12: 32,111,080 (GRCm39) M1T probably null Het
Ptcd3 A G 6: 71,869,464 (GRCm39) F378S probably damaging Het
Rab27b C A 18: 70,129,144 (GRCm39) R50L probably damaging Het
Rpl7a T G 2: 26,801,557 (GRCm39) F83C probably damaging Het
Slc8a2 A G 7: 15,868,194 (GRCm39) E142G probably damaging Het
Slc9a4 A T 1: 40,619,928 (GRCm39) I85L possibly damaging Het
Sorcs1 C A 19: 50,241,096 (GRCm39) W430L possibly damaging Het
Spaca6 T A 17: 18,058,790 (GRCm39) probably null Het
Synrg C A 11: 83,881,567 (GRCm39) A301E possibly damaging Het
Tcl1 G A 12: 105,184,969 (GRCm39) probably benign Het
Tecpr1 C T 5: 144,153,780 (GRCm39) V158M probably damaging Het
Tex2 T G 11: 106,459,230 (GRCm39) T67P Het
Tlr9 A T 9: 106,103,213 (GRCm39) I835L probably benign Het
Tmem185b G C 1: 119,454,406 (GRCm39) V56L probably benign Het
Tssk2 C T 16: 17,717,562 (GRCm39) R322W probably benign Het
Ttn T A 2: 76,571,735 (GRCm39) Y26386F probably benign Het
Txndc16 C A 14: 45,406,771 (GRCm39) R228I possibly damaging Het
Uspl1 T G 5: 149,138,701 (GRCm39) probably null Het
Vmn1r113 A T 7: 20,521,874 (GRCm39) H222L possibly damaging Het
Vnn1 T G 10: 23,776,587 (GRCm39) S313A probably benign Het
Zc3hc1 A T 6: 30,374,887 (GRCm39) L218Q possibly damaging Het
Znrf1 T G 8: 112,264,143 (GRCm39) L124R probably damaging Het
Zzz3 A T 3: 152,133,529 (GRCm39) N196Y possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGCATCTTCCCAGCCTCTG -3'
(R):5'- TGGAATCGTCCTCTTCGATG -3'

Sequencing Primer
(F):5'- GTACCCTGGAACTCACTGTGTAG -3'
(R):5'- GGAATCGTCCTCTTCGATGATGAC -3'
Posted On 2021-08-02