Incidental Mutation 'R8926:Intu'
ID 679525
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8926 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40531286-40704774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40653709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably damaging
Transcript: ENSMUST00000061590
AA Change: D32E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: D32E

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000091186
AA Change: D50E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,444 C1611Y probably damaging Het
Adgrf3 T A 5: 30,200,448 D296V possibly damaging Het
Ahi1 T C 10: 21,055,083 Y941H probably damaging Het
Bscl2 T C 19: 8,847,984 probably null Het
C1s1 C T 6: 124,533,366 G374D probably damaging Het
C1s1 T C 6: 124,536,363 D235G possibly damaging Het
Cacna1e C T 1: 154,701,334 V106I possibly damaging Het
Ccdc97 G A 7: 25,713,069 A316V probably benign Het
Ces1a A G 8: 93,025,213 V431A probably benign Het
Cftr C T 6: 18,268,004 S684L possibly damaging Het
Cgnl1 T A 9: 71,725,253 N272I probably benign Het
Csf2rb C T 15: 78,340,549 S169L probably benign Het
Cux1 T A 5: 136,309,550 probably benign Het
Cyp11b1 T A 15: 74,839,238 Y197F probably benign Het
Cyp1a2 T C 9: 57,681,078 K288E probably benign Het
Dapk1 T A 13: 60,760,920 W1116R probably damaging Het
Dclre1c A T 2: 3,433,790 D97V probably damaging Het
Efcc1 A G 6: 87,749,187 R323G probably benign Het
Epha6 T A 16: 59,839,299 I819F probably benign Het
Fam118b A T 9: 35,235,436 L45Q probably damaging Het
Fsd1l T G 4: 53,686,493 I302S probably benign Het
Fsip2 T A 2: 82,993,583 D6553E possibly damaging Het
Gje1 C T 10: 14,716,691 V116I probably benign Het
Gm7030 T A 17: 36,109,734 probably null Het
Helz C A 11: 107,672,683 H1650N unknown Het
Hltf T G 3: 20,069,159 probably null Het
Ipo9 C T 1: 135,386,214 probably benign Het
Lama5 G A 2: 180,193,990 T1217I probably benign Het
Lct T A 1: 128,300,411 Y1115F probably damaging Het
Lpgat1 T C 1: 191,760,008 L202P probably damaging Het
Lrp1 C T 10: 127,545,802 R3801H probably benign Het
Mtfmt T A 9: 65,437,132 Y113* probably null Het
Myh7 A G 14: 54,985,076 F801L probably benign Het
Myl4 G T 11: 104,585,746 M191I probably benign Het
Myo3a C A 2: 22,396,263 N614K possibly damaging Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nol10 C A 12: 17,416,870 Q584K probably benign Het
Nup210 C A 6: 91,053,452 G919C probably damaging Het
Olfr480 G A 7: 108,066,306 T134I probably benign Het
Olfr53 G A 7: 140,652,200 V74M probably benign Het
Pdcd6ip T A 9: 113,685,425 Q244L probably benign Het
Pde4d T C 13: 109,938,091 V410A probably benign Het
Plekha7 A T 7: 116,156,988 probably benign Het
Plpp4 A T 7: 129,321,487 probably null Het
Poln T C 5: 34,129,425 N133S probably benign Het
Ppfibp1 A G 6: 147,019,488 N575D probably damaging Het
Prex2 T A 1: 11,089,706 probably null Het
Prkar2b A G 12: 32,061,081 M1T probably null Het
Ptcd3 A G 6: 71,892,480 F378S probably damaging Het
Rab27b C A 18: 69,996,073 R50L probably damaging Het
Rpl7a T G 2: 26,911,545 F83C probably damaging Het
Slc8a2 A G 7: 16,134,269 E142G probably damaging Het
Slc9a4 A T 1: 40,580,768 I85L possibly damaging Het
Sorcs1 C A 19: 50,252,658 W430L possibly damaging Het
Spaca6 T A 17: 17,838,528 probably null Het
Synrg C A 11: 83,990,741 A301E possibly damaging Het
Tcl1 G A 12: 105,218,710 probably benign Het
Tecpr1 C T 5: 144,216,962 V158M probably damaging Het
Tex2 T G 11: 106,568,404 T67P Het
Tlr9 A T 9: 106,226,014 I835L probably benign Het
Tmem185b G C 1: 119,526,676 V56L probably benign Het
Tssk2 C T 16: 17,899,698 R322W probably benign Het
Ttn T A 2: 76,741,391 Y26386F probably benign Het
Txndc16 C A 14: 45,169,314 R228I possibly damaging Het
Uspl1 T G 5: 149,201,891 probably null Het
Vmn1r113 A T 7: 20,787,949 H222L possibly damaging Het
Vnn1 T G 10: 23,900,689 S313A probably benign Het
Zc3hc1 A T 6: 30,374,888 L218Q possibly damaging Het
Znrf1 T G 8: 111,537,511 L124R probably damaging Het
Zzz3 A T 3: 152,427,892 N196Y possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
R9164:Intu UTSW 3 40690703 missense probably damaging 1.00
R9191:Intu UTSW 3 40692511 missense probably damaging 0.99
R9547:Intu UTSW 3 40654106 missense probably benign
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGCATCTTCCCAGCCTCTG -3'
(R):5'- TGGAATCGTCCTCTTCGATG -3'

Sequencing Primer
(F):5'- GTACCCTGGAACTCACTGTGTAG -3'
(R):5'- GGAATCGTCCTCTTCGATGATGAC -3'
Posted On 2021-08-02