Incidental Mutation 'R8926:Tecpr1'
ID 679530
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 068770-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8926 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 144153780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 158 (V158M)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably damaging
Transcript: ENSMUST00000085701
AA Change: V158M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: V158M

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Meta Mutation Damage Score 0.2923 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,405,446 (GRCm39) D296V possibly damaging Het
Ahi1 T C 10: 20,930,982 (GRCm39) Y941H probably damaging Het
Bscl2 T C 19: 8,825,348 (GRCm39) probably null Het
C1s1 C T 6: 124,510,325 (GRCm39) G374D probably damaging Het
C1s1 T C 6: 124,513,322 (GRCm39) D235G possibly damaging Het
Cacna1e C T 1: 154,577,080 (GRCm39) V106I possibly damaging Het
Ccdc97 G A 7: 25,412,494 (GRCm39) A316V probably benign Het
Ces1a A G 8: 93,751,841 (GRCm39) V431A probably benign Het
Cftr C T 6: 18,268,003 (GRCm39) S684L possibly damaging Het
Cgnl1 T A 9: 71,632,535 (GRCm39) N272I probably benign Het
Csf2rb C T 15: 78,224,749 (GRCm39) S169L probably benign Het
Cux1 T A 5: 136,338,404 (GRCm39) probably benign Het
Cyp11b1 T A 15: 74,711,087 (GRCm39) Y197F probably benign Het
Cyp1a2 T C 9: 57,588,361 (GRCm39) K288E probably benign Het
Dapk1 T A 13: 60,908,734 (GRCm39) W1116R probably damaging Het
Dclre1c A T 2: 3,434,827 (GRCm39) D97V probably damaging Het
Efcc1 A G 6: 87,726,169 (GRCm39) R323G probably benign Het
Epha6 T A 16: 59,659,662 (GRCm39) I819F probably benign Het
Fam118b A T 9: 35,146,732 (GRCm39) L45Q probably damaging Het
Fcgbpl1 G A 7: 27,853,869 (GRCm39) C1611Y probably damaging Het
Fsd1l T G 4: 53,686,493 (GRCm39) I302S probably benign Het
Fsip2 T A 2: 82,823,927 (GRCm39) D6553E possibly damaging Het
Gje1 C T 10: 14,592,435 (GRCm39) V116I probably benign Het
H2-T9 T A 17: 36,420,626 (GRCm39) probably null Het
Helz C A 11: 107,563,509 (GRCm39) H1650N unknown Het
Hltf T G 3: 20,123,323 (GRCm39) probably null Het
Intu T A 3: 40,608,139 (GRCm39) D50E possibly damaging Het
Ipo9 C T 1: 135,313,952 (GRCm39) probably benign Het
Lama5 G A 2: 179,835,783 (GRCm39) T1217I probably benign Het
Lct T A 1: 128,228,148 (GRCm39) Y1115F probably damaging Het
Lpgat1 T C 1: 191,492,120 (GRCm39) L202P probably damaging Het
Lrp1 C T 10: 127,381,671 (GRCm39) R3801H probably benign Het
Mtfmt T A 9: 65,344,414 (GRCm39) Y113* probably null Het
Myh7 A G 14: 55,222,533 (GRCm39) F801L probably benign Het
Myl4 G T 11: 104,476,572 (GRCm39) M191I probably benign Het
Myo3a C A 2: 22,401,074 (GRCm39) N614K possibly damaging Het
Naa30 A G 14: 49,425,059 (GRCm39) N337S probably benign Het
Nol10 C A 12: 17,466,871 (GRCm39) Q584K probably benign Het
Nup210 C A 6: 91,030,434 (GRCm39) G919C probably damaging Het
Or13a20 G A 7: 140,232,113 (GRCm39) V74M probably benign Het
Or5p57 G A 7: 107,665,513 (GRCm39) T134I probably benign Het
Pdcd6ip T A 9: 113,514,493 (GRCm39) Q244L probably benign Het
Pde4d T C 13: 110,074,625 (GRCm39) V410A probably benign Het
Plekha7 A T 7: 115,756,223 (GRCm39) probably benign Het
Plpp4 A T 7: 128,923,211 (GRCm39) probably null Het
Poln T C 5: 34,286,769 (GRCm39) N133S probably benign Het
Ppfibp1 A G 6: 146,920,986 (GRCm39) N575D probably damaging Het
Prex2 T A 1: 11,159,930 (GRCm39) probably null Het
Prkar2b A G 12: 32,111,080 (GRCm39) M1T probably null Het
Ptcd3 A G 6: 71,869,464 (GRCm39) F378S probably damaging Het
Rab27b C A 18: 70,129,144 (GRCm39) R50L probably damaging Het
Rpl7a T G 2: 26,801,557 (GRCm39) F83C probably damaging Het
Slc8a2 A G 7: 15,868,194 (GRCm39) E142G probably damaging Het
Slc9a4 A T 1: 40,619,928 (GRCm39) I85L possibly damaging Het
Sorcs1 C A 19: 50,241,096 (GRCm39) W430L possibly damaging Het
Spaca6 T A 17: 18,058,790 (GRCm39) probably null Het
Synrg C A 11: 83,881,567 (GRCm39) A301E possibly damaging Het
Tcl1 G A 12: 105,184,969 (GRCm39) probably benign Het
Tex2 T G 11: 106,459,230 (GRCm39) T67P Het
Tlr9 A T 9: 106,103,213 (GRCm39) I835L probably benign Het
Tmem185b G C 1: 119,454,406 (GRCm39) V56L probably benign Het
Tssk2 C T 16: 17,717,562 (GRCm39) R322W probably benign Het
Ttn T A 2: 76,571,735 (GRCm39) Y26386F probably benign Het
Txndc16 C A 14: 45,406,771 (GRCm39) R228I possibly damaging Het
Uspl1 T G 5: 149,138,701 (GRCm39) probably null Het
Vmn1r113 A T 7: 20,521,874 (GRCm39) H222L possibly damaging Het
Vnn1 T G 10: 23,776,587 (GRCm39) S313A probably benign Het
Zc3hc1 A T 6: 30,374,887 (GRCm39) L218Q possibly damaging Het
Znrf1 T G 8: 112,264,143 (GRCm39) L124R probably damaging Het
Zzz3 A T 3: 152,133,529 (GRCm39) N196Y possibly damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACAAGGCTCTGTGACAGCAAAC -3'
(R):5'- CTGCTCCGGGATTGAATACC -3'

Sequencing Primer
(F):5'- TGGCCGATAAGGATGCCTATC -3'
(R):5'- GCTCCGGGATTGAATACCATACTTC -3'
Posted On 2021-08-02