Incidental Mutation 'R8926:Tlr9'
ID 679553
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8926 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106226014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 835 (I835L)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000062241
AA Change: I835L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: I835L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,444 C1611Y probably damaging Het
Adgrf3 T A 5: 30,200,448 D296V possibly damaging Het
Ahi1 T C 10: 21,055,083 Y941H probably damaging Het
Bscl2 T C 19: 8,847,984 probably null Het
C1s1 C T 6: 124,533,366 G374D probably damaging Het
C1s1 T C 6: 124,536,363 D235G possibly damaging Het
Cacna1e C T 1: 154,701,334 V106I possibly damaging Het
Ccdc97 G A 7: 25,713,069 A316V probably benign Het
Ces1a A G 8: 93,025,213 V431A probably benign Het
Cftr C T 6: 18,268,004 S684L possibly damaging Het
Cgnl1 T A 9: 71,725,253 N272I probably benign Het
Csf2rb C T 15: 78,340,549 S169L probably benign Het
Cux1 T A 5: 136,309,550 probably benign Het
Cyp11b1 T A 15: 74,839,238 Y197F probably benign Het
Cyp1a2 T C 9: 57,681,078 K288E probably benign Het
Dapk1 T A 13: 60,760,920 W1116R probably damaging Het
Dclre1c A T 2: 3,433,790 D97V probably damaging Het
Efcc1 A G 6: 87,749,187 R323G probably benign Het
Epha6 T A 16: 59,839,299 I819F probably benign Het
Fam118b A T 9: 35,235,436 L45Q probably damaging Het
Fsd1l T G 4: 53,686,493 I302S probably benign Het
Fsip2 T A 2: 82,993,583 D6553E possibly damaging Het
Gje1 C T 10: 14,716,691 V116I probably benign Het
Gm7030 T A 17: 36,109,734 probably null Het
Helz C A 11: 107,672,683 H1650N unknown Het
Hltf T G 3: 20,069,159 probably null Het
Intu T A 3: 40,653,709 D50E possibly damaging Het
Ipo9 C T 1: 135,386,214 probably benign Het
Lama5 G A 2: 180,193,990 T1217I probably benign Het
Lct T A 1: 128,300,411 Y1115F probably damaging Het
Lpgat1 T C 1: 191,760,008 L202P probably damaging Het
Lrp1 C T 10: 127,545,802 R3801H probably benign Het
Mtfmt T A 9: 65,437,132 Y113* probably null Het
Myh7 A G 14: 54,985,076 F801L probably benign Het
Myl4 G T 11: 104,585,746 M191I probably benign Het
Myo3a C A 2: 22,396,263 N614K possibly damaging Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nol10 C A 12: 17,416,870 Q584K probably benign Het
Nup210 C A 6: 91,053,452 G919C probably damaging Het
Olfr480 G A 7: 108,066,306 T134I probably benign Het
Olfr53 G A 7: 140,652,200 V74M probably benign Het
Pdcd6ip T A 9: 113,685,425 Q244L probably benign Het
Pde4d T C 13: 109,938,091 V410A probably benign Het
Plekha7 A T 7: 116,156,988 probably benign Het
Plpp4 A T 7: 129,321,487 probably null Het
Poln T C 5: 34,129,425 N133S probably benign Het
Ppfibp1 A G 6: 147,019,488 N575D probably damaging Het
Prex2 T A 1: 11,089,706 probably null Het
Prkar2b A G 12: 32,061,081 M1T probably null Het
Ptcd3 A G 6: 71,892,480 F378S probably damaging Het
Rab27b C A 18: 69,996,073 R50L probably damaging Het
Rpl7a T G 2: 26,911,545 F83C probably damaging Het
Slc8a2 A G 7: 16,134,269 E142G probably damaging Het
Slc9a4 A T 1: 40,580,768 I85L possibly damaging Het
Sorcs1 C A 19: 50,252,658 W430L possibly damaging Het
Spaca6 T A 17: 17,838,528 probably null Het
Synrg C A 11: 83,990,741 A301E possibly damaging Het
Tcl1 G A 12: 105,218,710 probably benign Het
Tecpr1 C T 5: 144,216,962 V158M probably damaging Het
Tex2 T G 11: 106,568,404 T67P Het
Tmem185b G C 1: 119,526,676 V56L probably benign Het
Tssk2 C T 16: 17,899,698 R322W probably benign Het
Ttn T A 2: 76,741,391 Y26386F probably benign Het
Txndc16 C A 14: 45,169,314 R228I possibly damaging Het
Uspl1 T G 5: 149,201,891 probably null Het
Vmn1r113 A T 7: 20,787,949 H222L possibly damaging Het
Vnn1 T G 10: 23,900,689 S313A probably benign Het
Zc3hc1 A T 6: 30,374,888 L218Q possibly damaging Het
Znrf1 T G 8: 111,537,511 L124R probably damaging Het
Zzz3 A T 3: 152,427,892 N196Y possibly damaging Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTAGACGTGAGAAGCAACCC -3'
(R):5'- TCGTTATACACCCAGTCGGC -3'

Sequencing Primer
(F):5'- GGCAGCCTTCGTAGACTTACTG -3'
(R):5'- CAACTGCGCTCTGTGCC -3'
Posted On 2021-08-02