Incidental Mutation 'R8926:Epha6'
ID 679573
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8926 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59839299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 819 (I819F)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068860
AA Change: I819F

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: I819F

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,444 C1611Y probably damaging Het
Adgrf3 T A 5: 30,200,448 D296V possibly damaging Het
Ahi1 T C 10: 21,055,083 Y941H probably damaging Het
Bscl2 T C 19: 8,847,984 probably null Het
C1s1 C T 6: 124,533,366 G374D probably damaging Het
C1s1 T C 6: 124,536,363 D235G possibly damaging Het
Cacna1e C T 1: 154,701,334 V106I possibly damaging Het
Ccdc97 G A 7: 25,713,069 A316V probably benign Het
Ces1a A G 8: 93,025,213 V431A probably benign Het
Cftr C T 6: 18,268,004 S684L possibly damaging Het
Cgnl1 T A 9: 71,725,253 N272I probably benign Het
Csf2rb C T 15: 78,340,549 S169L probably benign Het
Cux1 T A 5: 136,309,550 probably benign Het
Cyp11b1 T A 15: 74,839,238 Y197F probably benign Het
Cyp1a2 T C 9: 57,681,078 K288E probably benign Het
Dapk1 T A 13: 60,760,920 W1116R probably damaging Het
Dclre1c A T 2: 3,433,790 D97V probably damaging Het
Efcc1 A G 6: 87,749,187 R323G probably benign Het
Fam118b A T 9: 35,235,436 L45Q probably damaging Het
Fsd1l T G 4: 53,686,493 I302S probably benign Het
Fsip2 T A 2: 82,993,583 D6553E possibly damaging Het
Gje1 C T 10: 14,716,691 V116I probably benign Het
Gm7030 T A 17: 36,109,734 probably null Het
Helz C A 11: 107,672,683 H1650N unknown Het
Hltf T G 3: 20,069,159 probably null Het
Intu T A 3: 40,653,709 D50E possibly damaging Het
Ipo9 C T 1: 135,386,214 probably benign Het
Lama5 G A 2: 180,193,990 T1217I probably benign Het
Lct T A 1: 128,300,411 Y1115F probably damaging Het
Lpgat1 T C 1: 191,760,008 L202P probably damaging Het
Lrp1 C T 10: 127,545,802 R3801H probably benign Het
Mtfmt T A 9: 65,437,132 Y113* probably null Het
Myh7 A G 14: 54,985,076 F801L probably benign Het
Myl4 G T 11: 104,585,746 M191I probably benign Het
Myo3a C A 2: 22,396,263 N614K possibly damaging Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nol10 C A 12: 17,416,870 Q584K probably benign Het
Nup210 C A 6: 91,053,452 G919C probably damaging Het
Olfr480 G A 7: 108,066,306 T134I probably benign Het
Olfr53 G A 7: 140,652,200 V74M probably benign Het
Pdcd6ip T A 9: 113,685,425 Q244L probably benign Het
Pde4d T C 13: 109,938,091 V410A probably benign Het
Plekha7 A T 7: 116,156,988 probably benign Het
Plpp4 A T 7: 129,321,487 probably null Het
Poln T C 5: 34,129,425 N133S probably benign Het
Ppfibp1 A G 6: 147,019,488 N575D probably damaging Het
Prex2 T A 1: 11,089,706 probably null Het
Prkar2b A G 12: 32,061,081 M1T probably null Het
Ptcd3 A G 6: 71,892,480 F378S probably damaging Het
Rab27b C A 18: 69,996,073 R50L probably damaging Het
Rpl7a T G 2: 26,911,545 F83C probably damaging Het
Slc8a2 A G 7: 16,134,269 E142G probably damaging Het
Slc9a4 A T 1: 40,580,768 I85L possibly damaging Het
Sorcs1 C A 19: 50,252,658 W430L possibly damaging Het
Spaca6 T A 17: 17,838,528 probably null Het
Synrg C A 11: 83,990,741 A301E possibly damaging Het
Tcl1 G A 12: 105,218,710 probably benign Het
Tecpr1 C T 5: 144,216,962 V158M probably damaging Het
Tex2 T G 11: 106,568,404 T67P Het
Tlr9 A T 9: 106,226,014 I835L probably benign Het
Tmem185b G C 1: 119,526,676 V56L probably benign Het
Tssk2 C T 16: 17,899,698 R322W probably benign Het
Ttn T A 2: 76,741,391 Y26386F probably benign Het
Txndc16 C A 14: 45,169,314 R228I possibly damaging Het
Uspl1 T G 5: 149,201,891 probably null Het
Vmn1r113 A T 7: 20,787,949 H222L possibly damaging Het
Vnn1 T G 10: 23,900,689 S313A probably benign Het
Zc3hc1 A T 6: 30,374,888 L218Q possibly damaging Het
Znrf1 T G 8: 111,537,511 L124R probably damaging Het
Zzz3 A T 3: 152,427,892 N196Y possibly damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCATTGCAAAGAGTCATTTAC -3'
(R):5'- TCAATGGTCTTACAAATCTATGGGG -3'

Sequencing Primer
(F):5'- GCATTGCAAAGAGTCATTTACACTTC -3'
(R):5'- GGGGGAAAACAATAGCCCAAATCC -3'
Posted On 2021-08-02