Incidental Mutation 'R8927:Grin2b'
ID 679596
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 068771-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8927 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 135713233-136173511 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 135772341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 621 (Q621P)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: Q621P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Q621P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: Q621P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Q621P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,258,522 R190* probably null Het
4930402H24Rik T A 2: 130,737,380 R777* probably null Het
Aldh7a1 A T 18: 56,526,988 S529T probably benign Het
Carmil2 T G 8: 105,688,498 Y214* probably null Het
Ccdc105 T C 10: 78,752,424 Y184C probably damaging Het
Ccdc136 A G 6: 29,406,110 I152V probably damaging Het
Ccdc88c T C 12: 100,966,417 D285G possibly damaging Het
Clec4a3 T A 6: 122,969,369 F191I probably damaging Het
Dennd6b AGCTGGGGTCCCGC AGC 15: 89,185,577 probably null Het
Dlg5 A T 14: 24,156,479 S1222T Het
Dnah14 T G 1: 181,680,756 L1833W probably damaging Het
Dsg2 T C 18: 20,592,478 W549R probably damaging Het
Ezh2 A T 6: 47,533,779 V632E possibly damaging Het
Fam83a G A 15: 58,009,917 V381M probably benign Het
Fmo2 T C 1: 162,876,829 T503A probably benign Het
Foxo1 T C 3: 52,345,282 F289L probably damaging Het
Gckr A G 5: 31,299,559 E96G probably damaging Het
Gm18596 G A 10: 77,742,328 A104V unknown Het
Gm21680 A T 5: 25,971,349 N83K probably damaging Het
Gnb5 T C 9: 75,344,954 V393A possibly damaging Het
Gtsf2 T C 15: 103,444,356 I79V probably benign Het
Itga1 T C 13: 114,968,519 I1040V probably benign Het
Kif2b C T 11: 91,577,197 E87K probably benign Het
Klk1b8 G A 7: 43,954,782 G225S probably damaging Het
L3mbtl3 A T 10: 26,344,186 C94S unknown Het
Man2c1 T G 9: 57,141,172 Y872* probably null Het
Mical3 T A 6: 121,007,364 M832L probably benign Het
Mrc2 A G 11: 105,325,508 D41G probably benign Het
Nedd1 T A 10: 92,722,396 probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Notch3 C T 17: 32,153,818 R593Q probably benign Het
Nxpe3 T G 16: 55,849,634 E369D possibly damaging Het
Obscn T A 11: 59,086,869 T1802S possibly damaging Het
Olfr13 T C 6: 43,174,735 F250L probably benign Het
Olfr1301 A T 2: 111,754,762 H171L probably benign Het
Olfr1410 A G 1: 92,608,716 N293S probably damaging Het
Olfr393 A T 11: 73,847,580 F182I probably benign Het
Oscar A C 7: 3,611,748 V75G probably benign Het
Pcdhb17 G A 18: 37,487,319 A721T probably benign Het
Pcnx2 T C 8: 125,887,920 Y264C probably benign Het
Pear1 G T 3: 87,754,583 A495D probably damaging Het
Plekhf1 C A 7: 38,221,574 R190L probably damaging Het
Plppr5 T C 3: 117,575,883 V63A probably benign Het
Pyroxd1 T A 6: 142,354,711 F189Y probably damaging Het
Rab13 C T 3: 90,220,813 probably benign Het
Rptor C T 11: 119,891,210 T1121I probably benign Het
Scgb2b7 T C 7: 31,705,177 S33G probably benign Het
Slc25a36 A G 9: 97,100,073 probably null Het
Smtn T A 11: 3,529,477 H530L possibly damaging Het
Srrt C T 5: 137,298,808 C411Y probably benign Het
Stag1 C A 9: 100,705,245 P7Q possibly damaging Het
Tarm1 G A 7: 3,489,203 T248I possibly damaging Het
Trim6 C T 7: 104,232,448 A328V probably benign Het
Vmn1r189 T C 13: 22,102,641 I9V probably benign Het
Vmn2r93 A G 17: 18,326,238 T791A probably damaging Het
Vsig10l A G 7: 43,466,596 T454A probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8746:Grin2b UTSW 6 135922987 missense probably benign 0.02
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8963:Grin2b UTSW 6 136044009 missense probably damaging 1.00
R9075:Grin2b UTSW 6 135732511 frame shift probably null
R9076:Grin2b UTSW 6 135732511 frame shift probably null
R9172:Grin2b UTSW 6 135779257 missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135733401 missense probably damaging 1.00
R9740:Grin2b UTSW 6 135922870 critical splice donor site probably null
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACCAGCTACATGAGAACTTCTG -3'
(R):5'- CTAGGACCTTTTCGGCTCTG -3'

Sequencing Primer
(F):5'- GCTACATGAGAACTTCTGAGTATGGC -3'
(R):5'- CTCTGGGAACTTGTAGATCAAAGC -3'
Posted On 2021-08-02