Incidental Mutation 'R8928:Tbc1d23'
ID679707
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R8928 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57171789 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 603 (Y603H)
Ref Sequence ENSEMBL: ENSMUSP00000023431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000023432] [ENSMUST00000226586]
Predicted Effect probably damaging
Transcript: ENSMUST00000023431
AA Change: Y603H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749
AA Change: Y603H

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023432
SMART Domains Protein: ENSMUSP00000023432
Gene: ENSMUSG00000022751

DomainStartEndE-ValueType
Pfam:CN_hydrolase 5 256 3.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180999
Predicted Effect possibly damaging
Transcript: ENSMUST00000226586
AA Change: Y618H

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232573
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,251 Y528F probably benign Het
A630089N07Rik A T 16: 98,066,167 H198Q probably damaging Het
Abcb9 T C 5: 124,083,643 T223A probably benign Het
Actc1 T A 2: 114,050,400 K115* probably null Het
Angptl2 G A 2: 33,242,304 D308N probably benign Het
Arl4d A C 11: 101,667,066 Q139H possibly damaging Het
Aspm T A 1: 139,490,387 C2951* probably null Het
Atp23 A T 10: 126,887,493 *247R probably null Het
B3gnt7 T A 1: 86,305,117 S28R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bmp7 C T 2: 172,879,418 R288H probably damaging Het
Bsdc1 G T 4: 129,461,646 probably benign Het
C130060K24Rik C A 6: 65,381,613 S107* probably null Het
Ccdc146 T C 5: 21,333,062 E88G probably damaging Het
Ccdc73 C A 2: 104,992,197 D2E Het
Cdc5l C A 17: 45,410,913 R477L Het
Cdh22 T A 2: 165,123,584 H529L possibly damaging Het
Chchd3 T A 6: 32,804,016 E178D probably benign Het
Ciz1 A T 2: 32,367,500 R186* probably null Het
Copa T A 1: 172,104,170 H329Q probably null Het
Dcaf7 A G 11: 106,051,926 D233G probably damaging Het
Dclk2 G T 3: 86,831,741 P317Q probably damaging Het
Dsc3 A T 18: 19,974,177 H462Q probably benign Het
Fn1 T C 1: 71,599,376 N1998S probably benign Het
Fpr2 T C 17: 17,893,462 L240S possibly damaging Het
Fzd9 A T 5: 135,249,735 M432K probably damaging Het
Gm14025 A G 2: 129,040,869 S76P Het
Gm15922 A C 7: 3,739,359 N56K probably benign Het
Gm37596 T A 3: 93,692,643 T140S probably benign Het
Gm5862 T A 5: 26,021,680 I75F probably damaging Het
Gpr45 T A 1: 43,033,154 V319D probably damaging Het
Hist1h4j T C 13: 21,735,355 V87A possibly damaging Het
Igfn1 T A 1: 135,978,246 R275W probably damaging Het
Inafm1 G A 7: 16,273,055 A79V unknown Het
Itfg1 C T 8: 85,840,791 probably benign Het
Klhl35 T G 7: 99,471,014 I366S probably damaging Het
Lysmd1 A T 3: 95,138,520 I223F probably damaging Het
Mrps30 A G 13: 118,386,669 L189P probably damaging Het
Ms4a4d A C 19: 11,556,210 T152P probably benign Het
Mtcl1 A T 17: 66,448,633 I238K probably benign Het
Musk T C 4: 58,301,638 I132T probably damaging Het
Myh2 A T 11: 67,188,683 M989L probably benign Het
Myh8 G A 11: 67,283,255 R172H probably benign Het
Nt5c1a C T 4: 123,208,488 T69M possibly damaging Het
Nuak2 T A 1: 132,328,178 D196E probably damaging Het
Olfr1020 A T 2: 85,849,574 I41F possibly damaging Het
Olfr1055 T C 2: 86,347,746 T7A possibly damaging Het
Olfr1086 T C 2: 86,677,286 T16A probably benign Het
Olfr652 A T 7: 104,565,022 H267L probably damaging Het
Palb2 A T 7: 122,124,598 C643S probably damaging Het
Pde5a T A 3: 122,839,600 I706N probably damaging Het
Pdlim4 T C 11: 54,059,964 R100G probably benign Het
Pip5k1c T A 10: 81,293,072 V5E possibly damaging Het
Plekhm1 A G 11: 103,377,213 V644A probably benign Het
Plk2 T G 13: 110,399,216 V524G probably damaging Het
Ppl T A 16: 5,087,610 N1607I probably benign Het
Prag1 T G 8: 36,147,206 V1304G probably damaging Het
Prex1 C T 2: 166,585,075 V1077M probably damaging Het
Prmt6 T C 3: 110,250,932 S14G probably benign Het
Psrc1 T G 3: 108,386,657 S263R probably damaging Het
Rbp7 A T 4: 149,453,501 L36* probably null Het
Rgs12 G T 5: 34,966,289 W472L possibly damaging Het
Rrp8 C A 7: 105,734,866 C143F possibly damaging Het
Sart1 T C 19: 5,388,501 S43G probably benign Het
Setx A G 2: 29,126,959 T25A possibly damaging Het
Skint5 G A 4: 113,483,902 T1414I probably benign Het
Sorbs2 T A 8: 45,795,915 S734R probably damaging Het
Spon1 T C 7: 114,030,357 probably null Het
Sptbn1 C T 11: 30,138,962 V767I probably damaging Het
Srf T C 17: 46,549,169 I477V probably damaging Het
Tanc2 A G 11: 105,810,505 Y282C probably damaging Het
Tfap4 T C 16: 4,551,354 D134G probably damaging Het
Tmem200c A G 17: 68,841,738 T439A probably benign Het
Tmem63b A T 17: 45,664,982 M515K probably damaging Het
Tnc A T 4: 64,007,358 N980K probably damaging Het
Ttc23l T A 15: 10,530,634 L297F probably damaging Het
Vmn1r170 A G 7: 23,606,389 N72S possibly damaging Het
Vmn2r8 T C 5: 108,802,265 M239V Het
Vopp1 A G 6: 57,754,593 F138L probably damaging Het
Vps41 T A 13: 18,745,331 F79I probably benign Het
Zfp317 T C 9: 19,641,225 M1T probably null Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57189273 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57214162 critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57198857 critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 57170433 missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57214217 missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 57170382 missense probably damaging 1.00
R7601:Tbc1d23 UTSW 16 57181534 missense probably benign 0.10
R7877:Tbc1d23 UTSW 16 57173125 missense probably benign 0.35
R7886:Tbc1d23 UTSW 16 57189383 missense possibly damaging 0.95
R8202:Tbc1d23 UTSW 16 57191554 missense probably damaging 1.00
R8927:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
Z1177:Tbc1d23 UTSW 16 57182975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAGGAGCCTGCACTTAATGG -3'
(R):5'- TCTGAGAATGGCAGAATAGTCC -3'

Sequencing Primer
(F):5'- GCACTTAATGGGCTCTATTAATTCAG -3'
(R):5'- ACACATTACACTCAACTTCTCATTAG -3'
Posted On2021-08-02