Incidental Mutation 'R8929:Spg20'
ID 679725
Institutional Source Beutler Lab
Gene Symbol Spg20
Ensembl Gene ENSMUSG00000036580
Gene Name spastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
Synonyms TAHCCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock # R8929 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 55112108-55137322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55128558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 572 (S572P)
Ref Sequence ENSEMBL: ENSMUSP00000042367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118]
AlphaFold Q8R1X6
Predicted Effect possibly damaging
Transcript: ENSMUST00000044116
AA Change: S572P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580
AA Change: S572P

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107971
AA Change: S515P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580
AA Change: S515P

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117341
AA Change: S572P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580
AA Change: S572P

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118118
AA Change: S572P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580
AA Change: S572P

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Meta Mutation Damage Score 0.4877 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 A G 2: 180,172,937 K99E unknown Het
Agxt2 C A 15: 10,393,744 L375I probably benign Het
Akap13 T C 7: 75,609,004 S459P probably benign Het
Arfgef3 T A 10: 18,603,455 T1471S probably damaging Het
Atxn2l C G 7: 126,493,756 probably benign Het
Azi2 C A 9: 118,049,976 T141K probably damaging Het
B4galt6 A G 18: 20,688,365 S369P possibly damaging Het
BC051019 C T 7: 109,716,026 E341K probably damaging Het
Bdh1 G A 16: 31,456,894 D278N probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cdipt T G 7: 126,979,653 D205E probably damaging Het
Clec4b1 G T 6: 123,069,769 probably null Het
Clip4 T C 17: 71,831,208 L467S probably damaging Het
Cndp2 A G 18: 84,675,173 I154T probably benign Het
Cyp2j5 T C 4: 96,658,740 N179S possibly damaging Het
Dpf1 A T 7: 29,309,749 I100F probably benign Het
Dppa5a A G 9: 78,367,883 S46P probably benign Het
Epyc A G 10: 97,675,745 D200G probably benign Het
Ern2 C T 7: 122,170,140 A888T probably benign Het
Fndc3b C T 3: 27,542,104 S112N probably damaging Het
Fras1 T C 5: 96,769,507 V3462A probably damaging Het
Fstl5 T C 3: 76,707,831 I733T probably damaging Het
Gdf3 C T 6: 122,609,797 R57Q Het
Grwd1 A T 7: 45,830,632 D50E probably damaging Het
Hgf G T 5: 16,593,990 D339Y probably benign Het
Kat7 T C 11: 95,306,156 D19G probably damaging Het
Lefty1 A G 1: 180,937,725 E286G probably damaging Het
Lrriq3 T C 3: 155,188,182 F507L probably damaging Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Metap1 T C 3: 138,468,882 K247E probably benign Het
Muc4 T G 16: 32,753,994 I1290S probably benign Het
Muc4 A T 16: 32,754,017 T1298S possibly damaging Het
Nars G T 18: 64,511,824 H82Q probably benign Het
Ncapg2 A T 12: 116,452,363 E1121V probably damaging Het
Nebl C A 2: 17,393,180 E481* probably null Het
Pdap1 T C 5: 145,132,862 E111G probably damaging Het
Pds5b T C 5: 150,719,914 F67S probably damaging Het
Pole T C 5: 110,297,788 F510S probably damaging Het
Ptpn21 A T 12: 98,689,137 Y524N probably damaging Het
Ptpn4 A T 1: 119,667,548 M887K probably damaging Het
Sec24b T C 3: 130,009,858 D414G possibly damaging Het
Sema5b C A 16: 35,647,367 probably benign Het
Slain1 A T 14: 103,685,728 T252S probably damaging Het
Slc36a3 A G 11: 55,137,311 F164S probably damaging Het
Slc39a7 T C 17: 34,030,990 H90R unknown Het
Slc44a4 A T 17: 34,917,532 D58V probably damaging Het
Slc5a4a A G 10: 76,170,783 T340A probably benign Het
Sod2 C A 17: 13,015,087 N195K probably damaging Het
Sytl2 C T 7: 90,375,602 A266V probably benign Het
Tbx15 T A 3: 99,314,903 D227E probably damaging Het
Tfap2a A G 13: 40,728,832 V26A probably benign Het
Trank1 T A 9: 111,378,935 F1749L possibly damaging Het
Trpc6 A G 9: 8,643,410 probably benign Het
Ttn A T 2: 76,876,580 I9089N unknown Het
Unc13a T C 8: 71,651,191 T866A probably benign Het
Vmn1r212 T A 13: 22,883,324 S280C possibly damaging Het
Vmn2r82 A G 10: 79,396,707 T847A probably benign Het
Zcchc6 A G 13: 59,800,128 V793A probably benign Het
Zer1 A G 2: 30,110,869 L180P probably damaging Het
Zfp445 T G 9: 122,853,667 Y403S probably benign Het
Other mutations in Spg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spg20 APN 3 55121756 missense probably damaging 1.00
IGL01539:Spg20 APN 3 55117302 missense possibly damaging 0.95
IGL01982:Spg20 APN 3 55128490 splice site probably null
IGL02345:Spg20 APN 3 55117726 splice site probably null
IGL03217:Spg20 APN 3 55128491 splice site probably benign
IGL03344:Spg20 APN 3 55121685 missense probably benign 0.03
BB007:Spg20 UTSW 3 55128276 missense probably damaging 1.00
BB017:Spg20 UTSW 3 55128276 missense probably damaging 1.00
R0145:Spg20 UTSW 3 55127671 nonsense probably null
R0522:Spg20 UTSW 3 55128365 missense probably damaging 1.00
R1506:Spg20 UTSW 3 55117571 missense probably damaging 0.99
R2043:Spg20 UTSW 3 55127548 missense probably damaging 1.00
R2183:Spg20 UTSW 3 55117133 missense probably benign 0.43
R4022:Spg20 UTSW 3 55117736 missense probably damaging 1.00
R5154:Spg20 UTSW 3 55117329 missense probably damaging 1.00
R5869:Spg20 UTSW 3 55135510 missense probably benign 0.00
R5987:Spg20 UTSW 3 55126541 missense probably benign 0.00
R6142:Spg20 UTSW 3 55117248 missense probably damaging 1.00
R6185:Spg20 UTSW 3 55117219 missense probably damaging 1.00
R6652:Spg20 UTSW 3 55124827 missense probably benign 0.00
R6791:Spg20 UTSW 3 55127561 missense probably damaging 1.00
R7131:Spg20 UTSW 3 55121799 critical splice donor site probably null
R7930:Spg20 UTSW 3 55128276 missense probably damaging 1.00
R8005:Spg20 UTSW 3 55117352 missense probably benign 0.00
R8458:Spg20 UTSW 3 55124894 missense probably damaging 1.00
R8734:Spg20 UTSW 3 55124879 missense possibly damaging 0.92
R8791:Spg20 UTSW 3 55121679 missense probably benign 0.19
R9060:Spg20 UTSW 3 55124854 missense probably benign 0.02
R9172:Spg20 UTSW 3 55124846 missense possibly damaging 0.68
R9539:Spg20 UTSW 3 55127503 missense probably damaging 1.00
R9695:Spg20 UTSW 3 55126534 missense probably benign
RF009:Spg20 UTSW 3 55127606 missense probably benign 0.00
X0018:Spg20 UTSW 3 55135499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCAGCGAGTAGTGTTCAAG -3'
(R):5'- CTCAGGAGTTCGGTCAGTAGAC -3'

Sequencing Primer
(F):5'- TGTTCAAGGTAACAAAAGGCCTG -3'
(R):5'- CGGTCAGTAGACTAAAAATGTTCCC -3'
Posted On 2021-08-02