Incidental Mutation 'R8929:Tbx15'
ID 679727
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 068773-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R8929 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99222219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 227 (D227E)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: D227E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: D227E

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150756
AA Change: D121E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: D121E

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 A G 2: 179,814,730 (GRCm39) K99E unknown Het
Agxt2 C A 15: 10,393,830 (GRCm39) L375I probably benign Het
Akap13 T C 7: 75,258,752 (GRCm39) S459P probably benign Het
Arfgef3 T A 10: 18,479,203 (GRCm39) T1471S probably damaging Het
Atxn2l C G 7: 126,092,928 (GRCm39) probably benign Het
Azi2 C A 9: 117,879,044 (GRCm39) T141K probably damaging Het
B4galt6 A G 18: 20,821,422 (GRCm39) S369P possibly damaging Het
BC051019 C T 7: 109,315,233 (GRCm39) E341K probably damaging Het
Bdh1 G A 16: 31,275,712 (GRCm39) D278N probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cdipt T G 7: 126,578,825 (GRCm39) D205E probably damaging Het
Clec4b1 G T 6: 123,046,728 (GRCm39) probably null Het
Clip4 T C 17: 72,138,203 (GRCm39) L467S probably damaging Het
Cndp2 A G 18: 84,693,298 (GRCm39) I154T probably benign Het
Cyp2j5 T C 4: 96,546,977 (GRCm39) N179S possibly damaging Het
Dpf1 A T 7: 29,009,174 (GRCm39) I100F probably benign Het
Dppa5a A G 9: 78,275,165 (GRCm39) S46P probably benign Het
Epyc A G 10: 97,511,607 (GRCm39) D200G probably benign Het
Ern2 C T 7: 121,769,363 (GRCm39) A888T probably benign Het
Fndc3b C T 3: 27,596,253 (GRCm39) S112N probably damaging Het
Fras1 T C 5: 96,917,366 (GRCm39) V3462A probably damaging Het
Fstl5 T C 3: 76,615,138 (GRCm39) I733T probably damaging Het
Gdf3 C T 6: 122,586,756 (GRCm39) R57Q Het
Grwd1 A T 7: 45,480,056 (GRCm39) D50E probably damaging Het
Hgf G T 5: 16,798,988 (GRCm39) D339Y probably benign Het
Kat7 T C 11: 95,196,982 (GRCm39) D19G probably damaging Het
Lefty1 A G 1: 180,765,290 (GRCm39) E286G probably damaging Het
Lrriq3 T C 3: 154,893,819 (GRCm39) F507L probably damaging Het
Mcm4 T A 16: 15,448,289 (GRCm39) T423S probably benign Het
Metap1 T C 3: 138,174,643 (GRCm39) K247E probably benign Het
Muc4 T G 16: 32,575,285 (GRCm39) I1290S probably benign Het
Muc4 A T 16: 32,754,017 (GRCm38) T1298S possibly damaging Het
Nars1 G T 18: 64,644,895 (GRCm39) H82Q probably benign Het
Ncapg2 A T 12: 116,415,983 (GRCm39) E1121V probably damaging Het
Nebl C A 2: 17,397,991 (GRCm39) E481* probably null Het
Pdap1 T C 5: 145,069,672 (GRCm39) E111G probably damaging Het
Pds5b T C 5: 150,643,379 (GRCm39) F67S probably damaging Het
Pole T C 5: 110,445,654 (GRCm39) F510S probably damaging Het
Ptpn21 A T 12: 98,655,396 (GRCm39) Y524N probably damaging Het
Ptpn4 A T 1: 119,595,278 (GRCm39) M887K probably damaging Het
Sec24b T C 3: 129,803,507 (GRCm39) D414G possibly damaging Het
Sema5b C A 16: 35,467,737 (GRCm39) probably benign Het
Slain1 A T 14: 103,923,164 (GRCm39) T252S probably damaging Het
Slc36a3 A G 11: 55,028,137 (GRCm39) F164S probably damaging Het
Slc39a7 T C 17: 34,249,964 (GRCm39) H90R unknown Het
Slc44a4 A T 17: 35,136,508 (GRCm39) D58V probably damaging Het
Slc5a4a A G 10: 76,006,617 (GRCm39) T340A probably benign Het
Sod2 C A 17: 13,233,974 (GRCm39) N195K probably damaging Het
Spart T C 3: 55,035,979 (GRCm39) S572P possibly damaging Het
Sytl2 C T 7: 90,024,810 (GRCm39) A266V probably benign Het
Tfap2a A G 13: 40,882,308 (GRCm39) V26A probably benign Het
Trank1 T A 9: 111,208,003 (GRCm39) F1749L possibly damaging Het
Trpc6 A G 9: 8,643,411 (GRCm39) probably benign Het
Ttn A T 2: 76,706,924 (GRCm39) I9089N unknown Het
Tut7 A G 13: 59,947,942 (GRCm39) V793A probably benign Het
Unc13a T C 8: 72,103,835 (GRCm39) T866A probably benign Het
Vmn1r212 T A 13: 23,067,494 (GRCm39) S280C possibly damaging Het
Vmn2r82 A G 10: 79,232,541 (GRCm39) T847A probably benign Het
Zer1 A G 2: 30,000,881 (GRCm39) L180P probably damaging Het
Zfp445 T G 9: 122,682,732 (GRCm39) Y403S probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCTTGATTCTTCTGAGC -3'
(R):5'- AGCCTGGGTTTAATCAGCTC -3'

Sequencing Primer
(F):5'- GGCCTTGATTCTTCTGAGCATCTG -3'
(R):5'- GCCTGGGTTTAATCAGCTCTAAAG -3'
Posted On 2021-08-02