Mutagenetix > Incidental Mutation

Incidental Mutation 'R8929:Tbx15'

679727

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R8929 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 99314903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 227 (D227E)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: D227E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: D227E

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000150756
AA Change: D121E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: D121E

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrm1	A	G	2: 180,172,937	K99E	unknown	Het
Agxt2	C	A	15: 10,393,744	L375I	probably benign	Het
Akap13	T	C	7: 75,609,004	S459P	probably benign	Het
Arfgef3	T	A	10: 18,603,455	T1471S	probably damaging	Het
Atxn2l	C	G	7: 126,493,756		probably benign	Het
Azi2	C	A	9: 118,049,976	T141K	probably damaging	Het
B4galt6	A	G	18: 20,688,365	S369P	possibly damaging	Het
BC051019	C	T	7: 109,716,026	E341K	probably damaging	Het
Bdh1	G	A	16: 31,456,894	D278N	probably benign	Het
Cdh1	ACTCGAAATGATGTGGCTC	ACTC	8: 106,666,238		probably benign	Het
Cdipt	T	G	7: 126,979,653	D205E	probably damaging	Het
Clec4b1	G	T	6: 123,069,769		probably null	Het
Clip4	T	C	17: 71,831,208	L467S	probably damaging	Het
Cndp2	A	G	18: 84,675,173	I154T	probably benign	Het
Cyp2j5	T	C	4: 96,658,740	N179S	possibly damaging	Het
Dpf1	A	T	7: 29,309,749	I100F	probably benign	Het
Dppa5a	A	G	9: 78,367,883	S46P	probably benign	Het
Epyc	A	G	10: 97,675,745	D200G	probably benign	Het
Ern2	C	T	7: 122,170,140	A888T	probably benign	Het
Fndc3b	C	T	3: 27,542,104	S112N	probably damaging	Het
Fras1	T	C	5: 96,769,507	V3462A	probably damaging	Het
Fstl5	T	C	3: 76,707,831	I733T	probably damaging	Het
Gdf3	C	T	6: 122,609,797	R57Q		Het
Grwd1	A	T	7: 45,830,632	D50E	probably damaging	Het
Hgf	G	T	5: 16,593,990	D339Y	probably benign	Het
Kat7	T	C	11: 95,306,156	D19G	probably damaging	Het
Lefty1	A	G	1: 180,937,725	E286G	probably damaging	Het
Lrriq3	T	C	3: 155,188,182	F507L	probably damaging	Het
Mcm4	T	A	16: 15,630,425	T423S	probably benign	Het
Metap1	T	C	3: 138,468,882	K247E	probably benign	Het
Muc4	T	G	16: 32,753,994	I1290S	probably benign	Het
Muc4	A	T	16: 32,754,017	T1298S	possibly damaging	Het
Nars	G	T	18: 64,511,824	H82Q	probably benign	Het
Ncapg2	A	T	12: 116,452,363	E1121V	probably damaging	Het
Nebl	C	A	2: 17,393,180	E481*	probably null	Het
Pdap1	T	C	5: 145,132,862	E111G	probably damaging	Het
Pds5b	T	C	5: 150,719,914	F67S	probably damaging	Het
Pole	T	C	5: 110,297,788	F510S	probably damaging	Het
Ptpn21	A	T	12: 98,689,137	Y524N	probably damaging	Het
Ptpn4	A	T	1: 119,667,548	M887K	probably damaging	Het
Sec24b	T	C	3: 130,009,858	D414G	possibly damaging	Het
Sema5b	C	A	16: 35,647,367		probably benign	Het
Slain1	A	T	14: 103,685,728	T252S	probably damaging	Het
Slc36a3	A	G	11: 55,137,311	F164S	probably damaging	Het
Slc39a7	T	C	17: 34,030,990	H90R	unknown	Het
Slc44a4	A	T	17: 34,917,532	D58V	probably damaging	Het
Slc5a4a	A	G	10: 76,170,783	T340A	probably benign	Het
Sod2	C	A	17: 13,015,087	N195K	probably damaging	Het
Spg20	T	C	3: 55,128,558	S572P	possibly damaging	Het
Sytl2	C	T	7: 90,375,602	A266V	probably benign	Het
Tfap2a	A	G	13: 40,728,832	V26A	probably benign	Het
Trank1	T	A	9: 111,378,935	F1749L	possibly damaging	Het
Trpc6	A	G	9: 8,643,410		probably benign	Het
Ttn	A	T	2: 76,876,580	I9089N	unknown	Het
Unc13a	T	C	8: 71,651,191	T866A	probably benign	Het
Vmn1r212	T	A	13: 22,883,324	S280C	possibly damaging	Het
Vmn2r82	A	G	10: 79,396,707	T847A	probably benign	Het
Zcchc6	A	G	13: 59,800,128	V793A	probably benign	Het
Zer1	A	G	2: 30,110,869	L180P	probably damaging	Het
Zfp445	T	G	9: 122,853,667	Y403S	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCCTTGATTCTTCTGAGC -3'
(R):5'- AGCCTGGGTTTAATCAGCTC -3'

Sequencing Primer
(F):5'- GGCCTTGATTCTTCTGAGCATCTG -3'
(R):5'- GCCTGGGTTTAATCAGCTCTAAAG -3'

Posted On

2021-08-02