Incidental Mutation 'R8929:Cdipt'
ID 679746
Institutional Source Beutler Lab
Gene Symbol Cdipt
Ensembl Gene ENSMUSG00000030682
Gene Name CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
Synonyms D7Bwg0575e, 9530042F15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8929 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 126975914-126980501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 126979653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 205 (D205E)
Ref Sequence ENSEMBL: ENSMUSP00000032920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032920] [ENSMUST00000205437] [ENSMUST00000205830] [ENSMUST00000205903] [ENSMUST00000206170] [ENSMUST00000206296] [ENSMUST00000206346] [ENSMUST00000206450] [ENSMUST00000206780] [ENSMUST00000206794] [ENSMUST00000206816]
AlphaFold Q8VDP6
Predicted Effect probably damaging
Transcript: ENSMUST00000032920
AA Change: D205E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032920
Gene: ENSMUSG00000030682
AA Change: D205E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 9 72 2.4e-16 PFAM
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205437
Predicted Effect probably damaging
Transcript: ENSMUST00000205830
AA Change: D177E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000205903
Predicted Effect probably benign
Transcript: ENSMUST00000206170
Predicted Effect probably benign
Transcript: ENSMUST00000206296
Predicted Effect probably benign
Transcript: ENSMUST00000206346
Predicted Effect unknown
Transcript: ENSMUST00000206450
AA Change: M178R
Predicted Effect probably benign
Transcript: ENSMUST00000206780
Predicted Effect probably benign
Transcript: ENSMUST00000206794
Predicted Effect probably benign
Transcript: ENSMUST00000206816
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 A G 2: 180,172,937 K99E unknown Het
Agxt2 C A 15: 10,393,744 L375I probably benign Het
Akap13 T C 7: 75,609,004 S459P probably benign Het
Arfgef3 T A 10: 18,603,455 T1471S probably damaging Het
Atxn2l C G 7: 126,493,756 probably benign Het
Azi2 C A 9: 118,049,976 T141K probably damaging Het
B4galt6 A G 18: 20,688,365 S369P possibly damaging Het
BC051019 C T 7: 109,716,026 E341K probably damaging Het
Bdh1 G A 16: 31,456,894 D278N probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Clec4b1 G T 6: 123,069,769 probably null Het
Clip4 T C 17: 71,831,208 L467S probably damaging Het
Cndp2 A G 18: 84,675,173 I154T probably benign Het
Cyp2j5 T C 4: 96,658,740 N179S possibly damaging Het
Dpf1 A T 7: 29,309,749 I100F probably benign Het
Dppa5a A G 9: 78,367,883 S46P probably benign Het
Epyc A G 10: 97,675,745 D200G probably benign Het
Ern2 C T 7: 122,170,140 A888T probably benign Het
Fndc3b C T 3: 27,542,104 S112N probably damaging Het
Fras1 T C 5: 96,769,507 V3462A probably damaging Het
Fstl5 T C 3: 76,707,831 I733T probably damaging Het
Gdf3 C T 6: 122,609,797 R57Q Het
Grwd1 A T 7: 45,830,632 D50E probably damaging Het
Hgf G T 5: 16,593,990 D339Y probably benign Het
Kat7 T C 11: 95,306,156 D19G probably damaging Het
Lefty1 A G 1: 180,937,725 E286G probably damaging Het
Lrriq3 T C 3: 155,188,182 F507L probably damaging Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Metap1 T C 3: 138,468,882 K247E probably benign Het
Muc4 T G 16: 32,753,994 I1290S probably benign Het
Muc4 A T 16: 32,754,017 T1298S possibly damaging Het
Nars G T 18: 64,511,824 H82Q probably benign Het
Ncapg2 A T 12: 116,452,363 E1121V probably damaging Het
Nebl C A 2: 17,393,180 E481* probably null Het
Pdap1 T C 5: 145,132,862 E111G probably damaging Het
Pds5b T C 5: 150,719,914 F67S probably damaging Het
Pole T C 5: 110,297,788 F510S probably damaging Het
Ptpn21 A T 12: 98,689,137 Y524N probably damaging Het
Ptpn4 A T 1: 119,667,548 M887K probably damaging Het
Sec24b T C 3: 130,009,858 D414G possibly damaging Het
Sema5b C A 16: 35,647,367 probably benign Het
Slain1 A T 14: 103,685,728 T252S probably damaging Het
Slc36a3 A G 11: 55,137,311 F164S probably damaging Het
Slc39a7 T C 17: 34,030,990 H90R unknown Het
Slc44a4 A T 17: 34,917,532 D58V probably damaging Het
Slc5a4a A G 10: 76,170,783 T340A probably benign Het
Sod2 C A 17: 13,015,087 N195K probably damaging Het
Spg20 T C 3: 55,128,558 S572P possibly damaging Het
Sytl2 C T 7: 90,375,602 A266V probably benign Het
Tbx15 T A 3: 99,314,903 D227E probably damaging Het
Tfap2a A G 13: 40,728,832 V26A probably benign Het
Trank1 T A 9: 111,378,935 F1749L possibly damaging Het
Trpc6 A G 9: 8,643,410 probably benign Het
Ttn A T 2: 76,876,580 I9089N unknown Het
Unc13a T C 8: 71,651,191 T866A probably benign Het
Vmn1r212 T A 13: 22,883,324 S280C possibly damaging Het
Vmn2r82 A G 10: 79,396,707 T847A probably benign Het
Zcchc6 A G 13: 59,800,128 V793A probably benign Het
Zer1 A G 2: 30,110,869 L180P probably damaging Het
Zfp445 T G 9: 122,853,667 Y403S probably benign Het
Other mutations in Cdipt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Cdipt APN 7 126979553 missense possibly damaging 0.84
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0446:Cdipt UTSW 7 126978264 missense probably damaging 1.00
R0578:Cdipt UTSW 7 126979530 splice site probably null
R0828:Cdipt UTSW 7 126976920 missense probably damaging 1.00
R2020:Cdipt UTSW 7 126976933 missense possibly damaging 0.69
R4669:Cdipt UTSW 7 126978406 missense possibly damaging 0.82
R4731:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4732:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4733:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R5590:Cdipt UTSW 7 126979532 splice site probably null
R5870:Cdipt UTSW 7 126978922 missense probably benign 0.28
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6084:Cdipt UTSW 7 126979601 missense probably benign 0.10
R6090:Cdipt UTSW 7 126976959 missense possibly damaging 0.94
R7571:Cdipt UTSW 7 126979622 missense probably benign 0.05
R8245:Cdipt UTSW 7 126979560 missense probably benign
Z1177:Cdipt UTSW 7 126976944 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAATTTCTCCGAGGGACCAC -3'
(R):5'- CAGGTTGGGTCTAATCATCAGG -3'

Sequencing Primer
(F):5'- CTGGGGGAGAGAGAGGCCTC -3'
(R):5'- TGGGTCTAATCATCAGGATTAAAGAG -3'
Posted On 2021-08-02