Incidental Mutation 'R8929:Slc5a4a'
ID 679754
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8929 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 76147451-76189265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76170783 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 340 (T340A)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020450
AA Change: T340A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: T340A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 A G 2: 180,172,937 K99E unknown Het
Agxt2 C A 15: 10,393,744 L375I probably benign Het
Akap13 T C 7: 75,609,004 S459P probably benign Het
Arfgef3 T A 10: 18,603,455 T1471S probably damaging Het
Atxn2l C G 7: 126,493,756 probably benign Het
Azi2 C A 9: 118,049,976 T141K probably damaging Het
B4galt6 A G 18: 20,688,365 S369P possibly damaging Het
BC051019 C T 7: 109,716,026 E341K probably damaging Het
Bdh1 G A 16: 31,456,894 D278N probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cdipt T G 7: 126,979,653 D205E probably damaging Het
Clec4b1 G T 6: 123,069,769 probably null Het
Clip4 T C 17: 71,831,208 L467S probably damaging Het
Cndp2 A G 18: 84,675,173 I154T probably benign Het
Cyp2j5 T C 4: 96,658,740 N179S possibly damaging Het
Dpf1 A T 7: 29,309,749 I100F probably benign Het
Dppa5a A G 9: 78,367,883 S46P probably benign Het
Epyc A G 10: 97,675,745 D200G probably benign Het
Ern2 C T 7: 122,170,140 A888T probably benign Het
Fndc3b C T 3: 27,542,104 S112N probably damaging Het
Fras1 T C 5: 96,769,507 V3462A probably damaging Het
Fstl5 T C 3: 76,707,831 I733T probably damaging Het
Gdf3 C T 6: 122,609,797 R57Q Het
Grwd1 A T 7: 45,830,632 D50E probably damaging Het
Hgf G T 5: 16,593,990 D339Y probably benign Het
Kat7 T C 11: 95,306,156 D19G probably damaging Het
Lefty1 A G 1: 180,937,725 E286G probably damaging Het
Lrriq3 T C 3: 155,188,182 F507L probably damaging Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Metap1 T C 3: 138,468,882 K247E probably benign Het
Muc4 T G 16: 32,753,994 I1290S probably benign Het
Muc4 A T 16: 32,754,017 T1298S possibly damaging Het
Nars G T 18: 64,511,824 H82Q probably benign Het
Ncapg2 A T 12: 116,452,363 E1121V probably damaging Het
Nebl C A 2: 17,393,180 E481* probably null Het
Pdap1 T C 5: 145,132,862 E111G probably damaging Het
Pds5b T C 5: 150,719,914 F67S probably damaging Het
Pole T C 5: 110,297,788 F510S probably damaging Het
Ptpn21 A T 12: 98,689,137 Y524N probably damaging Het
Ptpn4 A T 1: 119,667,548 M887K probably damaging Het
Sec24b T C 3: 130,009,858 D414G possibly damaging Het
Sema5b C A 16: 35,647,367 probably benign Het
Slain1 A T 14: 103,685,728 T252S probably damaging Het
Slc36a3 A G 11: 55,137,311 F164S probably damaging Het
Slc39a7 T C 17: 34,030,990 H90R unknown Het
Slc44a4 A T 17: 34,917,532 D58V probably damaging Het
Sod2 C A 17: 13,015,087 N195K probably damaging Het
Spg20 T C 3: 55,128,558 S572P possibly damaging Het
Sytl2 C T 7: 90,375,602 A266V probably benign Het
Tbx15 T A 3: 99,314,903 D227E probably damaging Het
Tfap2a A G 13: 40,728,832 V26A probably benign Het
Trank1 T A 9: 111,378,935 F1749L possibly damaging Het
Trpc6 A G 9: 8,643,410 probably benign Het
Ttn A T 2: 76,876,580 I9089N unknown Het
Unc13a T C 8: 71,651,191 T866A probably benign Het
Vmn1r212 T A 13: 22,883,324 S280C possibly damaging Het
Vmn2r82 A G 10: 79,396,707 T847A probably benign Het
Zcchc6 A G 13: 59,800,128 V793A probably benign Het
Zer1 A G 2: 30,110,869 L180P probably damaging Het
Zfp445 T G 9: 122,853,667 Y403S probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 splice site probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
R8785:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R8993:Slc5a4a UTSW 10 76186535 missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76166712 missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76186562 missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76166774 missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTCAGAAGACAGATTAGACATC -3'
(R):5'- CCCGCAGAAGCTGTTTTCTC -3'

Sequencing Primer
(F):5'- GATTAGACATCATTTTCTGGTTGCC -3'
(R):5'- GTCTAACTCAAGTTCTGGAGGACC -3'
Posted On 2021-08-02