Mutagenetix > Incidental Mutation

Incidental Mutation 'R8831:Atp2c2'

679786

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8831 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

splice site (100 bp from exon)

DNA Base Change (assembly)

A to G at 119749294 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000092794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171]

AlphaFold

A7L9Z8

Predicted Effect

probably null
Transcript: ENSMUST00000095171

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

99% (81/82)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,182,136	I320T	probably benign	Het
5430403G16Rik	A	T	5: 109,676,308	S425R	probably benign	Het
A230072I06Rik	A	T	8: 12,279,688	I48L	unknown	Het
Abcc3	A	C	11: 94,350,961	C1415G	probably damaging	Het
Abcf3	C	T	16: 20,550,464	R205C	probably damaging	Het
Abcg5	G	T	17: 84,668,995	H471Q	probably damaging	Het
Actl6b	G	A	5: 137,567,043	R363Q	probably damaging	Het
Adcy1	T	A	11: 7,161,362	D884E	probably benign	Het
Aldh3a1	A	G	11: 61,216,316	Y282C	probably damaging	Het
Amdhd2	A	G	17: 24,157,738		probably null	Het
Arfgef3	A	G	10: 18,652,743	S299P	possibly damaging	Het
Asic2	A	T	11: 81,967,900	N95K	probably damaging	Het
Atrn	T	C	2: 130,906,601	L14P	probably benign	Het
BC027072	A	T	17: 71,752,310	V124E	probably benign	Het
C8b	A	G	4: 104,790,677	Y355C	probably damaging	Het
Carm1	A	G	9: 21,580,367	E244G	probably damaging	Het
Cd300c2	A	T	11: 115,001,018	C39*	probably null	Het
Cish	T	A	9: 107,300,472	F116I	probably damaging	Het
Clstn1	G	A	4: 149,646,323	R837Q	probably benign	Het
Cox10	A	G	11: 63,964,480	F325S	probably damaging	Het
Ctps	A	T	4: 120,567,310	S36T	possibly damaging	Het
Dchs2	T	C	3: 83,285,363	L1705P	probably benign	Het
Defb25	C	A	2: 152,622,979	V17L	probably benign	Het
Dhx16	A	G	17: 35,888,108	D782G	probably damaging	Het
Dhx30	A	G	9: 110,088,251	S399P	probably benign	Het
Dhx58	T	A	11: 100,703,980	K30M	probably damaging	Het
Drc7	G	A	8: 95,062,217	R301Q	probably damaging	Het
Dsg1a	T	C	18: 20,320,308	V21A	probably damaging	Het
Ercc6	T	A	14: 32,560,827		probably null	Het
Fam193a	A	G	5: 34,459,030	T850A	probably benign	Het
Fgf10	A	G	13: 118,789,135	D150G	probably damaging	Het
Flii	A	T	11: 60,725,248	N28K	probably benign	Het
Gfi1	G	A	5: 107,720,272	R377C	probably damaging	Het
Gfra2	A	T	14: 70,967,063	N324I	probably benign	Het
Gm10308	A	G	17: 91,089,003	R118G	unknown	Het
Gm10801	T	A	2: 98,663,989	V137E	probably damaging	Het
Gm4450	A	T	3: 98,446,731	W151R	probably benign	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Ift80	G	A	3: 68,962,250	A236V	probably damaging	Het
Il1rn	A	T	2: 24,349,493	T134S	possibly damaging	Het
Il6st	G	T	13: 112,504,380	D897Y	probably damaging	Het
Imp4	T	C	1: 34,444,364	M257T	probably benign	Het
Impdh2	T	C	9: 108,564,758	L377S	probably damaging	Het
Kdm1b	C	A	13: 47,064,141	L359I	possibly damaging	Het
Kidins220	A	T	12: 25,036,455	I963L	possibly damaging	Het
Mdm4	T	C	1: 133,003,863	R148G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Ncor1	A	T	11: 62,369,408	D505E	probably benign	Het
Necab3	A	T	2: 154,554,687	L107Q	probably damaging	Het
Nkx2-4	G	A	2: 147,085,194	P51L	probably benign	Het
Nol11	T	C	11: 107,176,836	T388A	probably benign	Het
Npc1	T	A	18: 12,200,820	M735L	probably benign	Het
Nr1h3	C	A	2: 91,190,746	R232L	probably benign	Het
Nrcam	T	A	12: 44,544,897		probably null	Het
Olfr341	G	A	2: 36,479,782	T116I	possibly damaging	Het
Olfr591	T	A	7: 103,172,996	I214L	probably benign	Het
Pabpn1	T	C	14: 54,894,457	V101A	probably damaging	Het
Pcbp2	A	G	15: 102,486,018	D217G	probably benign	Het
Pcdhb12	A	G	18: 37,437,333	M511V	probably benign	Het
Phf3	T	A	1: 30,821,266	K828*	probably null	Het
Plcg1	G	C	2: 160,747,812	K85N	probably benign	Het
Prag1	A	T	8: 36,146,737	T1148S	probably benign	Het
Prmt3	A	G	7: 49,828,981	E430G	probably null	Het
Prx	G	T	7: 27,518,113	V819F	probably damaging	Het
Ptpn18	A	T	1: 34,472,190	R338W	probably null	Het
Rab6a	T	C	7: 100,634,724	Y128H	probably benign	Het
Rgs2	T	C	1: 144,001,759	Y186C	probably damaging	Het
Rhbdl1	C	T	17: 25,834,883	V342M	probably damaging	Het
Rpn1	A	G	6: 88,084,793	Q88R	probably benign	Het
Slc19a2	C	T	1: 164,256,874	T111M	probably damaging	Het
Slc35e4	G	A	11: 3,913,087	P34L	possibly damaging	Het
Slc7a6os	A	T	8: 106,210,557	D90E	probably benign	Het
Ssh3	A	G	19: 4,269,025	V19A	possibly damaging	Het
Susd1	C	T	4: 59,379,594		probably benign	Het
Tcf19	A	T	17: 35,514,897	M121K	possibly damaging	Het
Tcp11	G	A	17: 28,080,219	R21C	probably damaging	Het
Tcp11l2	A	G	10: 84,613,658	I496V	probably damaging	Het
Tenm3	C	T	8: 48,276,382	A1530T		Het
Tmem127	T	A	2: 127,257,059	V171D	probably damaging	Het
Tyrp1	G	A	4: 80,835,162	C30Y	probably damaging	Het
Usp48	A	T	4: 137,613,769	D360V	probably damaging	Het
Vamp4	T	A	1: 162,574,383	D11E	possibly damaging	Het
Vmn1r14	T	C	6: 57,233,520	F28L	probably benign	Het
Vmn2r69	G	T	7: 85,409,810	C514*	probably null	Het
Vmn2r84	G	A	10: 130,391,099	A290V	probably benign	Het
Zhx3	T	A	2: 160,780,771	Y492F	probably benign	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGACATTCCTGGGTCTCGTG -3'
(R):5'- GGGACAGAATCAACATGACTGC -3'

Sequencing Primer
(F):5'- TCTCGTGGGCATCATCGAC -3'
(R):5'- TGACTGCCCCAAACCATAATGATG -3'

Posted On

2021-08-26