Incidental Mutation 'R8831:Atp2c2'
ID 679786
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 068659-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8831 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation splice site (100 bp from exon)
DNA Base Change (assembly) A to G at 120476033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably null
Transcript: ENSMUST00000095171
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A T 8: 12,329,688 (GRCm39) I48L unknown Het
Abcc3 A C 11: 94,241,787 (GRCm39) C1415G probably damaging Het
Abcf3 C T 16: 20,369,214 (GRCm39) R205C probably damaging Het
Abcg5 G T 17: 84,976,423 (GRCm39) H471Q probably damaging Het
Actl6b G A 5: 137,565,305 (GRCm39) R363Q probably damaging Het
Adcy1 T A 11: 7,111,362 (GRCm39) D884E probably benign Het
Aldh3a1 A G 11: 61,107,142 (GRCm39) Y282C probably damaging Het
Amdhd2 A G 17: 24,376,712 (GRCm39) probably null Het
Arfgef3 A G 10: 18,528,491 (GRCm39) S299P possibly damaging Het
Asic2 A T 11: 81,858,726 (GRCm39) N95K probably damaging Het
Atrn T C 2: 130,748,521 (GRCm39) L14P probably benign Het
C8b A G 4: 104,647,874 (GRCm39) Y355C probably damaging Het
Carm1 A G 9: 21,491,663 (GRCm39) E244G probably damaging Het
Cd300c2 A T 11: 114,891,844 (GRCm39) C39* probably null Het
Cish T A 9: 107,177,671 (GRCm39) F116I probably damaging Het
Clstn1 G A 4: 149,730,780 (GRCm39) R837Q probably benign Het
Cox10 A G 11: 63,855,306 (GRCm39) F325S probably damaging Het
Cplane1 T C 15: 8,211,620 (GRCm39) I320T probably benign Het
Ctps1 A T 4: 120,424,507 (GRCm39) S36T possibly damaging Het
Dchs2 T C 3: 83,192,670 (GRCm39) L1705P probably benign Het
Defb25 C A 2: 152,464,899 (GRCm39) V17L probably benign Het
Dhx16 A G 17: 36,199,000 (GRCm39) D782G probably damaging Het
Dhx30 A G 9: 109,917,319 (GRCm39) S399P probably benign Het
Dhx58 T A 11: 100,594,806 (GRCm39) K30M probably damaging Het
Drc7 G A 8: 95,788,845 (GRCm39) R301Q probably damaging Het
Dsg1a T C 18: 20,453,365 (GRCm39) V21A probably damaging Het
Ercc6 T A 14: 32,282,784 (GRCm39) probably null Het
Fam193a A G 5: 34,616,374 (GRCm39) T850A probably benign Het
Fgf10 A G 13: 118,925,671 (GRCm39) D150G probably damaging Het
Flii A T 11: 60,616,074 (GRCm39) N28K probably benign Het
Gfi1 G A 5: 107,868,138 (GRCm39) R377C probably damaging Het
Gfra2 A T 14: 71,204,503 (GRCm39) N324I probably benign Het
Gm10308 A G 17: 91,396,431 (GRCm39) R118G unknown Het
Gm10801 T A 2: 98,494,334 (GRCm39) V137E probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd3b9 A T 3: 98,354,047 (GRCm39) W151R probably benign Het
Ift80 G A 3: 68,869,583 (GRCm39) A236V probably damaging Het
Il1rn A T 2: 24,239,505 (GRCm39) T134S possibly damaging Het
Il6st G T 13: 112,640,914 (GRCm39) D897Y probably damaging Het
Imp4 T C 1: 34,483,445 (GRCm39) M257T probably benign Het
Impdh2 T C 9: 108,441,957 (GRCm39) L377S probably damaging Het
Kdm1b C A 13: 47,217,617 (GRCm39) L359I possibly damaging Het
Kidins220 A T 12: 25,086,454 (GRCm39) I963L possibly damaging Het
Mdm4 T C 1: 132,931,601 (GRCm39) R148G probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Ncor1 A T 11: 62,260,234 (GRCm39) D505E probably benign Het
Necab3 A T 2: 154,396,607 (GRCm39) L107Q probably damaging Het
Nkx2-4 G A 2: 146,927,114 (GRCm39) P51L probably benign Het
Nol11 T C 11: 107,067,662 (GRCm39) T388A probably benign Het
Npc1 T A 18: 12,333,877 (GRCm39) M735L probably benign Het
Nr1h3 C A 2: 91,021,091 (GRCm39) R232L probably benign Het
Nrcam T A 12: 44,591,680 (GRCm39) probably null Het
Or1j13 G A 2: 36,369,794 (GRCm39) T116I possibly damaging Het
Or52s1b T A 7: 102,822,203 (GRCm39) I214L probably benign Het
Pabpn1 T C 14: 55,131,914 (GRCm39) V101A probably damaging Het
Pcare A T 17: 72,059,305 (GRCm39) V124E probably benign Het
Pcbp2 A G 15: 102,394,453 (GRCm39) D217G probably benign Het
Pcdhb12 A G 18: 37,570,386 (GRCm39) M511V probably benign Het
Phf3 T A 1: 30,860,347 (GRCm39) K828* probably null Het
Plcg1 G C 2: 160,589,732 (GRCm39) K85N probably benign Het
Prag1 A T 8: 36,613,891 (GRCm39) T1148S probably benign Het
Prmt3 A G 7: 49,478,729 (GRCm39) E430G probably null Het
Prx G T 7: 27,217,538 (GRCm39) V819F probably damaging Het
Ptpn18 A T 1: 34,511,271 (GRCm39) R338W probably null Het
Rab6a T C 7: 100,283,931 (GRCm39) Y128H probably benign Het
Rgs2 T C 1: 143,877,497 (GRCm39) Y186C probably damaging Het
Rhbdl1 C T 17: 26,053,857 (GRCm39) V342M probably damaging Het
Rpn1 A G 6: 88,061,775 (GRCm39) Q88R probably benign Het
Slc19a2 C T 1: 164,084,443 (GRCm39) T111M probably damaging Het
Slc35e4 G A 11: 3,863,087 (GRCm39) P34L possibly damaging Het
Slc7a6os A T 8: 106,937,189 (GRCm39) D90E probably benign Het
Ssh3 A G 19: 4,319,053 (GRCm39) V19A possibly damaging Het
Susd1 C T 4: 59,379,594 (GRCm39) probably benign Het
Tcf19 A T 17: 35,825,794 (GRCm39) M121K possibly damaging Het
Tcp11 G A 17: 28,299,193 (GRCm39) R21C probably damaging Het
Tcp11l2 A G 10: 84,449,522 (GRCm39) I496V probably damaging Het
Tenm3 C T 8: 48,729,417 (GRCm39) A1530T Het
Tmem127 T A 2: 127,098,979 (GRCm39) V171D probably damaging Het
Tyrp1 G A 4: 80,753,399 (GRCm39) C30Y probably damaging Het
Usp48 A T 4: 137,341,080 (GRCm39) D360V probably damaging Het
Vamp4 T A 1: 162,401,952 (GRCm39) D11E possibly damaging Het
Vmn1r14 T C 6: 57,210,505 (GRCm39) F28L probably benign Het
Vmn2r69 G T 7: 85,059,018 (GRCm39) C514* probably null Het
Vmn2r84 G A 10: 130,226,968 (GRCm39) A290V probably benign Het
Zfp1007 A T 5: 109,824,174 (GRCm39) S425R probably benign Het
Zhx3 T A 2: 160,622,691 (GRCm39) Y492F probably benign Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACATTCCTGGGTCTCGTG -3'
(R):5'- GGGACAGAATCAACATGACTGC -3'

Sequencing Primer
(F):5'- TCTCGTGGGCATCATCGAC -3'
(R):5'- TGACTGCCCCAAACCATAATGATG -3'
Posted On 2021-08-26