Incidental Mutation 'R8884:Itpr3'
ID 679787
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8884 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 27118677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]
AlphaFold P70227
Predicted Effect probably benign
Transcript: ENSMUST00000025045
Predicted Effect probably null
Transcript: ENSMUST00000049308
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118613
Predicted Effect probably benign
Transcript: ENSMUST00000119227
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,488 F168Y probably damaging Het
4932415D10Rik T A 10: 82,283,652 H4508L probably damaging Het
4932438H23Rik T C 16: 91,055,849 Y133C probably damaging Het
Aasdh A G 5: 76,891,794 S223P possibly damaging Het
Abca8a T C 11: 110,074,115 D453G possibly damaging Het
Acsl6 T A 11: 54,345,902 F541I probably damaging Het
Agfg1 A T 1: 82,882,389 K326* probably null Het
Aldh1l2 T C 10: 83,508,677 N448S probably benign Het
Alx4 A G 2: 93,643,010 K118E possibly damaging Het
Atp9b T A 18: 80,795,347 T451S Het
B4galt6 A T 18: 20,689,015 N307K probably benign Het
Cacna1s G A 1: 136,115,243 M1569I probably benign Het
Cacng6 C T 7: 3,430,468 T121I probably damaging Het
Cdc5l C A 17: 45,433,541 probably benign Het
Cdh7 A T 1: 110,100,130 D535V probably damaging Het
Chrnb3 T C 8: 27,393,918 F228L possibly damaging Het
Clca1 A T 3: 145,013,996 D404E probably benign Het
Commd8 G A 5: 72,168,171 probably benign Het
Cpn1 T A 19: 43,966,176 Q337L possibly damaging Het
Dctn6 T C 8: 34,090,779 T180A probably benign Het
Ddx60 A G 8: 61,994,519 E1180G possibly damaging Het
Dock4 T A 12: 40,806,885 L1239Q probably damaging Het
Dopey2 T C 16: 93,759,662 I469T probably benign Het
Enpep A T 3: 129,321,403 I240N possibly damaging Het
Fat3 G A 9: 16,029,984 T1337I probably damaging Het
Fbxw13 T A 9: 109,181,401 M390L probably benign Het
Fgr C T 4: 132,986,298 P46S probably benign Het
Galnt1 T A 18: 24,267,584 M249K probably benign Het
Gm40460 A T 7: 142,240,818 C87* probably null Het
Hcn4 C T 9: 58,853,422 R417C unknown Het
Insr T C 8: 3,155,679 N1370S probably benign Het
Kif14 G A 1: 136,486,351 E722K Het
Larp6 G A 9: 60,713,399 G65E Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc16 G A 9: 18,644,200 T3599I unknown Het
Muc5b T C 7: 141,849,419 F706L unknown Het
Nbea A T 3: 55,805,299 M2119K probably benign Het
Olfr46 C T 7: 140,610,703 P171L probably damaging Het
Olfr538 A T 7: 140,574,311 T53S probably benign Het
Paip1 G A 13: 119,438,017 V83I probably damaging Het
Pdcd1lg2 G T 19: 29,445,918 probably null Het
Pde7a G A 3: 19,227,694 A464V probably benign Het
Pfkfb2 A G 1: 130,706,476 F155L probably damaging Het
Pimreg A G 11: 72,045,687 D192G possibly damaging Het
Prkd3 T C 17: 78,974,764 D320G probably damaging Het
Rgs7 A G 1: 175,153,164 V98A probably benign Het
Ric3 C T 7: 109,038,481 G356D probably benign Het
Rsph4a T C 10: 33,905,844 probably benign Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sez6l T C 5: 112,475,044 T214A probably damaging Het
Sipa1l1 T G 12: 82,363,097 V595G probably damaging Het
Spta1 G T 1: 174,217,688 probably null Het
Ssbp2 A G 13: 91,688,870 probably benign Het
Syne1 T G 10: 5,231,822 Q4171P possibly damaging Het
Tgfb2 G A 1: 186,632,710 T232I probably damaging Het
Tmem175 A G 5: 108,646,461 S486G probably benign Het
Tmprss15 A G 16: 79,024,769 V466A probably benign Het
Treh C G 9: 44,684,503 probably benign Het
Ttc14 A G 3: 33,800,547 S8G unknown Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Vmn1r44 T C 6: 89,893,476 L68P probably damaging Het
Vmn2r37 T G 7: 9,215,917 L489F probably benign Het
Vmn2r52 T A 7: 10,158,807 T802S probably damaging Het
Wsb2 T A 5: 117,370,704 F68I probably benign Het
Zbtb8os T C 4: 129,343,131 V113A probably benign Het
Zfp354a A T 11: 51,059,978 probably benign Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27118677 unclassified probably benign
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9294:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9477:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
R9694:Itpr3 UTSW 17 27115953 missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27089941 missense probably benign 0.15
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGATCCTAGAAGGTGAGACCG -3'
(R):5'- GAAGCCACTGACTGCTGATG -3'

Sequencing Primer
(F):5'- ACCGGCGTCTACAGGATAG -3'
(R):5'- ACTGACTGCTGATGGCCCAC -3'
Posted On 2021-08-26