Incidental Mutation 'R8896:Itpr3'
ID 679793
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms Itpr-3, Ip3r3, tf
MMRRC Submission 068698-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27276278-27341197 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 27337651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]
AlphaFold P70227
Predicted Effect probably benign
Transcript: ENSMUST00000025045
Predicted Effect probably null
Transcript: ENSMUST00000049308
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118613
Predicted Effect probably benign
Transcript: ENSMUST00000119227
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,291,233 (GRCm39) S784A probably benign Het
Ap3d1 T A 10: 80,552,425 (GRCm39) H581L probably benign Het
Atp11a T C 8: 12,899,781 (GRCm39) Y915H probably damaging Het
Atp4b T C 8: 13,437,514 (GRCm39) D213G probably benign Het
Bcl11a A G 11: 24,113,640 (GRCm39) S328G probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cadps2 T A 6: 23,410,876 (GRCm39) Y685F probably damaging Het
Ccdc88b C T 19: 6,831,203 (GRCm39) A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 179,958,373 (GRCm39) probably benign Het
Cep152 A T 2: 125,408,155 (GRCm39) V1396D possibly damaging Het
Ces1c T C 8: 93,833,254 (GRCm39) I404V probably benign Het
Cr2 A T 1: 194,851,581 (GRCm39) M137K possibly damaging Het
Cyp2d40 T C 15: 82,644,454 (GRCm39) Y257C unknown Het
Dennd1c T A 17: 57,381,512 (GRCm39) D116V probably damaging Het
Dph2 G A 4: 117,747,575 (GRCm39) R270* probably null Het
Dpp8 A C 9: 64,985,318 (GRCm39) H792P possibly damaging Het
Dusp29 T C 14: 21,736,763 (GRCm39) D113G probably benign Het
Efs T C 14: 55,157,756 (GRCm39) E185G possibly damaging Het
Eml3 A G 19: 8,914,056 (GRCm39) E480G probably damaging Het
Fam193a A G 5: 34,583,828 (GRCm39) T336A probably benign Het
Fermt1 C T 2: 132,783,852 (GRCm39) probably benign Het
Galnt4 T A 10: 98,945,955 (GRCm39) V560D probably damaging Het
Gbp2b C A 3: 142,309,327 (GRCm39) T146K probably damaging Het
Gbp5 C T 3: 142,211,308 (GRCm39) T346I probably damaging Het
Glrx G T 13: 75,995,317 (GRCm39) C79F probably damaging Het
Glt8d2 T A 10: 82,490,616 (GRCm39) T225S probably damaging Het
Grm3 A G 5: 9,562,483 (GRCm39) F456L possibly damaging Het
Gse1 T G 8: 121,303,185 (GRCm39) S1109A unknown Het
Gstp3 A T 19: 4,108,573 (GRCm39) L63Q probably damaging Het
Hapln3 G A 7: 78,767,239 (GRCm39) R267W probably benign Het
Herc4 T A 10: 63,147,286 (GRCm39) I801N possibly damaging Het
Ido1 G T 8: 25,077,880 (GRCm39) D153E probably benign Het
Kcnj9 T A 1: 172,153,360 (GRCm39) S255C probably damaging Het
Kpna3 T C 14: 61,629,294 (GRCm39) N39D probably benign Het
Krt39 A T 11: 99,409,095 (GRCm39) S269T probably damaging Het
Lfng G A 5: 140,598,978 (GRCm39) V296I probably benign Het
Lrit3 T A 3: 129,585,132 (GRCm39) I209F probably damaging Het
Map4k5 T A 12: 69,870,275 (GRCm39) D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 (GRCm39) P652L probably benign Het
Med30 G A 15: 52,584,516 (GRCm39) V145I possibly damaging Het
Megf6 T A 4: 154,326,860 (GRCm39) D163E probably damaging Het
Meltf T A 16: 31,709,522 (GRCm39) probably benign Het
Mindy4 T C 6: 55,255,223 (GRCm39) L567P probably benign Het
Mppe1 T C 18: 67,370,472 (GRCm39) D75G probably damaging Het
Muc4 C T 16: 32,754,673 (GRCm38) P1516S probably benign Het
Myo3b C A 2: 70,069,160 (GRCm39) F494L probably damaging Het
Nedd4l A G 18: 65,298,688 (GRCm39) T226A probably benign Het
Nod1 A G 6: 54,921,277 (GRCm39) V347A probably benign Het
Nup210 A T 6: 91,019,235 (GRCm39) probably null Het
Nup210l A G 3: 90,025,932 (GRCm39) R185G probably damaging Het
Oma1 T C 4: 103,210,829 (GRCm39) L445S probably damaging Het
Or13p10 A T 4: 118,523,502 (GRCm39) M263L probably benign Het
Or5ac20 A T 16: 59,104,452 (GRCm39) M136K probably damaging Het
Or8g36 A G 9: 39,422,770 (GRCm39) L82P probably damaging Het
Oxsm A T 14: 16,242,677 (GRCm38) F31I probably benign Het
Pdcd5 A T 7: 35,346,795 (GRCm39) M1K probably null Het
Pkd1l2 T C 8: 117,740,615 (GRCm39) T2161A possibly damaging Het
Pla2g3 A T 11: 3,442,151 (GRCm39) S404C probably null Het
Plec A G 15: 76,078,560 (GRCm39) V60A unknown Het
Prpsap2 A G 11: 61,643,736 (GRCm39) S66P possibly damaging Het
Rarb A G 14: 16,436,804 (GRCm38) L239P probably damaging Het
Ryr3 A T 2: 112,583,395 (GRCm39) Y2845* probably null Het
Spta1 T C 1: 174,045,548 (GRCm39) C1569R probably damaging Het
Stard13 G A 5: 150,986,115 (GRCm39) S465L probably damaging Het
Tmub1 A T 5: 24,651,680 (GRCm39) S80T probably benign Het
Trpv5 A G 6: 41,647,847 (GRCm39) F322S probably damaging Het
Vmn2r5 G A 3: 64,411,203 (GRCm39) A455V probably benign Het
Washc4 T A 10: 83,405,882 (GRCm39) N459K probably damaging Het
Wdr11 C T 7: 129,207,437 (GRCm39) R300* probably null Het
Zer1 A G 2: 29,993,430 (GRCm39) F559L probably damaging Het
Zfat A T 15: 68,052,519 (GRCm39) V425D probably damaging Het
Zfp738 G A 13: 67,817,910 (GRCm39) L694F Het
Zfp839 C T 12: 110,835,277 (GRCm39) A844V probably damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27,302,603 (GRCm39) missense probably benign 0.05
IGL00980:Itpr3 APN 17 27,329,930 (GRCm39) missense probably benign
IGL01151:Itpr3 APN 17 27,310,503 (GRCm39) missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27,318,739 (GRCm39) missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27,337,569 (GRCm39) missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27,336,152 (GRCm39) missense probably benign 0.02
IGL01897:Itpr3 APN 17 27,330,236 (GRCm39) missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27,340,449 (GRCm39) missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27,323,069 (GRCm39) missense probably benign
IGL02063:Itpr3 APN 17 27,338,997 (GRCm39) missense probably benign 0.01
IGL02146:Itpr3 APN 17 27,336,249 (GRCm39) missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27,317,416 (GRCm39) missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27,318,588 (GRCm39) missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27,317,153 (GRCm39) missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27,333,486 (GRCm39) splice site probably benign
IGL02651:Itpr3 APN 17 27,325,372 (GRCm39) missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27,323,530 (GRCm39) missense probably benign 0.21
IGL03001:Itpr3 APN 17 27,308,586 (GRCm39) splice site probably benign
IGL03004:Itpr3 APN 17 27,316,952 (GRCm39) missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27,310,907 (GRCm39) missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27,338,240 (GRCm39) missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27,330,242 (GRCm39) missense probably benign
IGL03404:Itpr3 APN 17 27,310,492 (GRCm39) missense probably damaging 1.00
Allure UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
alopecia UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Beauty UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
Opuesto UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
Paradox UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
Pulchritude UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27,339,951 (GRCm39) missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27,317,296 (GRCm39) missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0104:Itpr3 UTSW 17 27,314,966 (GRCm39) missense probably benign 0.01
R0195:Itpr3 UTSW 17 27,333,088 (GRCm39) missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27,308,293 (GRCm39) missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27,332,793 (GRCm39) missense probably benign
R0485:Itpr3 UTSW 17 27,330,903 (GRCm39) missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27,326,263 (GRCm39) missense probably benign 0.09
R0781:Itpr3 UTSW 17 27,329,529 (GRCm39) missense probably benign 0.00
R0890:Itpr3 UTSW 17 27,307,985 (GRCm39) nonsense probably null
R1028:Itpr3 UTSW 17 27,310,343 (GRCm39) missense probably benign 0.04
R1144:Itpr3 UTSW 17 27,333,897 (GRCm39) missense probably benign 0.01
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1458:Itpr3 UTSW 17 27,337,346 (GRCm39) missense probably benign 0.01
R1463:Itpr3 UTSW 17 27,336,128 (GRCm39) splice site probably benign
R1472:Itpr3 UTSW 17 27,333,199 (GRCm39) missense probably benign 0.09
R1529:Itpr3 UTSW 17 27,324,459 (GRCm39) splice site probably null
R1533:Itpr3 UTSW 17 27,314,534 (GRCm39) missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27,333,121 (GRCm39) missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27,335,581 (GRCm39) critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27,307,987 (GRCm39) missense probably benign
R1726:Itpr3 UTSW 17 27,330,664 (GRCm39) missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27,338,997 (GRCm39) missense probably benign 0.01
R1940:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27,321,785 (GRCm39) missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2064:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2065:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2067:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2068:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2219:Itpr3 UTSW 17 27,334,027 (GRCm39) missense probably benign
R2248:Itpr3 UTSW 17 27,334,033 (GRCm39) missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27,332,553 (GRCm39) missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27,314,889 (GRCm39) missense probably benign
R2864:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R2865:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R3778:Itpr3 UTSW 17 27,314,446 (GRCm39) missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27,332,814 (GRCm39) missense probably benign 0.01
R3979:Itpr3 UTSW 17 27,310,546 (GRCm39) missense probably damaging 1.00
R3979:Itpr3 UTSW 17 27,304,105 (GRCm39) missense probably benign 0.23
R4224:Itpr3 UTSW 17 27,326,232 (GRCm39) missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27,325,298 (GRCm39) missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27,330,948 (GRCm39) missense probably benign 0.00
R4466:Itpr3 UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27,323,586 (GRCm39) missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27,312,257 (GRCm39) missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27,304,121 (GRCm39) missense probably benign 0.30
R4921:Itpr3 UTSW 17 27,316,979 (GRCm39) missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27,302,582 (GRCm39) missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27,308,885 (GRCm39) missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27,317,397 (GRCm39) missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27,335,663 (GRCm39) missense probably benign 0.38
R5518:Itpr3 UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27,326,308 (GRCm39) missense probably benign 0.09
R5566:Itpr3 UTSW 17 27,334,926 (GRCm39) missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27,322,880 (GRCm39) missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27,332,493 (GRCm39) missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27,337,540 (GRCm39) missense probably benign 0.42
R5658:Itpr3 UTSW 17 27,326,852 (GRCm39) missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27,325,379 (GRCm39) missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27,305,950 (GRCm39) missense probably benign 0.02
R5878:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R5889:Itpr3 UTSW 17 27,334,039 (GRCm39) missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27,336,867 (GRCm39) missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27,329,895 (GRCm39) missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27,323,575 (GRCm39) missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27,330,174 (GRCm39) missense probably benign 0.03
R6233:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27,314,449 (GRCm39) missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6515:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6516:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6955:Itpr3 UTSW 17 27,340,441 (GRCm39) missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27,329,554 (GRCm39) missense probably benign 0.00
R7064:Itpr3 UTSW 17 27,308,269 (GRCm39) missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27,337,535 (GRCm39) missense probably benign 0.00
R7349:Itpr3 UTSW 17 27,326,786 (GRCm39) splice site probably null
R7469:Itpr3 UTSW 17 27,340,028 (GRCm39) missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27,313,774 (GRCm39) missense probably benign 0.09
R7510:Itpr3 UTSW 17 27,308,013 (GRCm39) missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27,329,862 (GRCm39) missense probably benign 0.01
R7616:Itpr3 UTSW 17 27,307,951 (GRCm39) missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27,317,088 (GRCm39) missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27,315,037 (GRCm39) missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27,337,571 (GRCm39) nonsense probably null
R7871:Itpr3 UTSW 17 27,336,153 (GRCm39) missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27,335,751 (GRCm39) missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27,331,002 (GRCm39) critical splice donor site probably null
R8065:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8067:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8230:Itpr3 UTSW 17 27,326,711 (GRCm39) critical splice donor site probably null
R8263:Itpr3 UTSW 17 27,334,887 (GRCm39) nonsense probably null
R8264:Itpr3 UTSW 17 27,323,086 (GRCm39) synonymous silent
R8269:Itpr3 UTSW 17 27,312,258 (GRCm39) missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27,306,622 (GRCm39) missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27,325,199 (GRCm39) missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27,334,893 (GRCm39) missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27,330,900 (GRCm39) missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8679:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8846:Itpr3 UTSW 17 27,330,996 (GRCm39) missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8885:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8886:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8887:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8888:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8891:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8975:Itpr3 UTSW 17 27,335,628 (GRCm39) missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9026:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9063:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9087:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9088:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9089:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9090:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9091:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9200:Itpr3 UTSW 17 27,326,636 (GRCm39) missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9271:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9294:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27,314,899 (GRCm39) missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9434:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9443:Itpr3 UTSW 17 27,324,523 (GRCm39) missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9474:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9475:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9476:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9477:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9507:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9508:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9511:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9694:Itpr3 UTSW 17 27,334,927 (GRCm39) missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27,308,915 (GRCm39) missense probably benign 0.15
V7732:Itpr3 UTSW 17 27,330,000 (GRCm39) splice site probably null
V7732:Itpr3 UTSW 17 27,329,998 (GRCm39) splice site probably benign
Z1088:Itpr3 UTSW 17 27,332,502 (GRCm39) missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27,338,961 (GRCm39) missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27,333,903 (GRCm39) missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGATCCTAGAAGGTGAGACCG -3'
(R):5'- AAGCCACTGACTGCTGATG -3'

Sequencing Primer
(F):5'- ACCGGCGTCTACAGGATAG -3'
(R):5'- ACTGACTGCTGATGGCCCAC -3'
Posted On 2021-08-26