Incidental Mutation 'R8734:Cyp2b9'
ID 679801
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms 16\alphaoh-a, phenobarbitol inducible, type a, Cyp2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8734 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 26173411-26210661 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 26198610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
AlphaFold P12790
Predicted Effect probably benign
Transcript: ENSMUST00000082214
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,782,416 C5S probably damaging Het
Actl6a G A 3: 32,719,955 D275N probably benign Het
Ahctf1 C A 1: 179,780,865 E681* probably null Het
Ankub1 G A 3: 57,692,285 S21L probably benign Het
Apmap T A 2: 150,588,904 K178N probably benign Het
Arhgap15 T A 2: 44,243,118 N345K probably damaging Het
Armc8 A G 9: 99,520,485 V379A probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
Atp5h T C 11: 115,416,863 E94G possibly damaging Het
B3gnt3 G A 8: 71,693,501 T128M probably damaging Het
Ccdc88c T A 12: 100,940,135 T1040S probably damaging Het
Crot C T 5: 8,978,208 R247Q probably benign Het
Dcaf8 T C 1: 172,193,860 W540R probably benign Het
Galnt11 T C 5: 25,250,224 I186T possibly damaging Het
Gne T A 4: 44,072,911 probably benign Het
Gpr37 A T 6: 25,688,202 F299I probably benign Het
Gpr37l1 C T 1: 135,167,429 A26T probably benign Het
Grm4 A G 17: 27,438,791 Y414H probably damaging Het
Kcnh1 T C 1: 192,506,012 I954T possibly damaging Het
Lias T C 5: 65,404,209 Y308H probably damaging Het
Lrrc27 T A 7: 139,216,599 probably benign Het
Lrrc8a C T 2: 30,256,607 H478Y probably benign Het
Mdh2 T A 5: 135,784,129 probably benign Het
Mug1 T A 6: 121,871,381 I688K probably benign Het
Nrp1 A G 8: 128,480,939 D605G probably benign Het
Nt5dc3 A G 10: 86,833,999 Y486C possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,649 C241* probably null Het
Olfr1413 T A 1: 92,573,399 V76D possibly damaging Het
Olfr285 A T 15: 98,313,073 L159H probably damaging Het
Pam A T 1: 97,834,402 probably benign Het
Pcolce A G 5: 137,611,288 L14P probably damaging Het
Pcsk6 T C 7: 65,931,733 I254T probably benign Het
Pdzrn3 A T 6: 101,151,606 C700S probably damaging Het
Pglyrp2 A G 17: 32,416,002 F462S probably damaging Het
Pla2g16 T A 19: 7,574,982 Y21N possibly damaging Het
Plekhm1 A T 11: 103,394,952 L219Q probably damaging Het
Prkch T A 12: 73,585,244 S28T possibly damaging Het
Prrc2c A T 1: 162,679,512 S2529R possibly damaging Het
Prss3 G T 6: 41,373,893 A221D probably damaging Het
Rbm33 T A 5: 28,352,876 probably benign Het
Retreg1 T C 15: 25,968,407 L83S probably damaging Het
Robo2 C T 16: 73,967,763 probably benign Het
Slc25a47 T A 12: 108,854,321 F84I probably benign Het
Sntb2 A G 8: 107,001,688 I423V probably benign Het
Spg20 A T 3: 55,124,879 D378V possibly damaging Het
Spint2 A T 7: 29,259,410 F127Y probably damaging Het
Stag3 A G 5: 138,311,788 T1233A probably benign Het
Tenm3 A G 8: 48,349,356 I390T probably benign Het
Tigd2 A G 6: 59,210,199 D17G probably damaging Het
Tln2 C A 9: 67,272,654 A812S probably benign Het
Tmem234 A G 4: 129,607,524 T133A probably benign Het
Trnp1 A G 4: 133,498,069 F130S possibly damaging Het
Tsr1 A G 11: 74,903,826 S436G probably benign Het
Ttn T C 2: 76,710,688 I33985V probably benign Het
Usp34 A C 11: 23,444,184 D2278A Het
Vav3 T A 3: 109,657,969 F727Y probably benign Het
Vcl T C 14: 21,010,168 probably null Het
Vps13c T A 9: 67,973,403 D3507E probably damaging Het
Vtn A G 11: 78,500,264 probably benign Het
Zfp319 A G 8: 95,328,310 S422P possibly damaging Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 26198505 missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 26210235 missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 26187715 missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 26201104 missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 26187814 critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 26173520 missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 26198600 splice site probably benign
IGL03307:Cyp2b9 APN 7 26199051 missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 26186753 splice site probably benign
R0025:Cyp2b9 UTSW 7 26200813 missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 26173474 missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 26187007 nonsense probably null
R0370:Cyp2b9 UTSW 7 26210106 missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 26200907 missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 26186675 missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 26200783 missense probably benign
R1879:Cyp2b9 UTSW 7 26198569 missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 26186707 missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 26210103 missense probably damaging 1.00
R4088:Cyp2b9 UTSW 7 26173456 missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 26198443 missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 26200755 missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 26201125 missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 26187742 missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 26187655 missense probably benign
R5862:Cyp2b9 UTSW 7 26187807 missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 26173574 missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 26186987 missense probably benign 0.13
R6992:Cyp2b9 UTSW 7 26201139 missense probably benign 0.00
R7515:Cyp2b9 UTSW 7 26199171 missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 26186942 missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 26201092 missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 26186686 nonsense probably null
R8790:Cyp2b9 UTSW 7 26198742 intron probably benign
R8839:Cyp2b9 UTSW 7 26200760 missense probably damaging 0.96
R9209:Cyp2b9 UTSW 7 26173579 missense possibly damaging 0.52
R9723:Cyp2b9 UTSW 7 26210171 nonsense probably null
R9787:Cyp2b9 UTSW 7 26200834 missense probably benign 0.04
Z1177:Cyp2b9 UTSW 7 26201163 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TACAGGTCACCTCCTAGGCC -3'
(R):5'- GGGTTTTGTCTGCCAGCCTC -3'

Sequencing Primer
(F):5'- GAGCTCTTCTCTGGATTCCTGAAG -3'
(R):5'- GCCAGCCTCATTCTTCTGTGG -3'
Posted On 2021-08-30