Incidental Mutation 'R8704:Agbl1'
ID 679806
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene Name ATP/GTP binding protein-like 1
Synonyms Nna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8704 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 76229887-77124698 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 76589554 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026854
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107442
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156166
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,882,663 Q628R possibly damaging Het
Brf2 A G 8: 27,128,471 V35A possibly damaging Het
Chtf8 A C 8: 106,886,040 M89R probably benign Het
Copa A G 1: 172,104,126 I315V probably benign Het
Csmd2 G A 4: 128,197,354 E229K Het
Etf1 T C 18: 34,906,086 E376G probably damaging Het
Fat2 T A 11: 55,281,311 I2859F probably damaging Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Gal3st3 T C 19: 5,302,635 V30A probably benign Het
Gars C T 6: 55,063,230 R381C probably damaging Het
Gjd3 C T 11: 98,982,619 R133H probably damaging Het
Haspin T C 11: 73,138,002 N87S probably benign Het
Hcrt A T 11: 100,761,926 probably benign Het
Heatr6 T A 11: 83,777,278 M866K probably benign Het
Igf1r T C 7: 68,170,054 probably benign Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Lypd5 A G 7: 24,351,557 H31R possibly damaging Het
Mib2 A G 4: 155,659,163 M275T possibly damaging Het
Mmp19 G A 10: 128,798,834 V440I probably benign Het
Nefm T C 14: 68,121,061 E508G unknown Het
Nlrp4a A T 7: 26,457,138 I763L probably benign Het
Olfr1006 T A 2: 85,674,218 H311L Het
Olfr485 A T 7: 108,159,504 V123D possibly damaging Het
Pcdhb1 T A 18: 37,266,349 V451D possibly damaging Het
Pfkfb2 T C 1: 130,698,043 N467D probably benign Het
Ptprc G A 1: 138,115,624 T63I probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Rhobtb2 G A 14: 69,793,924 P584L probably damaging Het
Rhoc G C 3: 104,792,026 A44P probably damaging Het
Sardh T C 2: 27,230,465 E435G possibly damaging Het
Stfa1 A T 16: 36,285,174 D89V probably damaging Het
Tec T C 5: 72,768,762 K316E probably damaging Het
Tsen15 A T 1: 152,371,790 Y150* probably null Het
Ugt1a5 T C 1: 88,166,365 I105T probably benign Het
Usp25 A G 16: 77,059,290 D257G probably benign Het
Vmn1r195 A G 13: 22,278,888 Y176C possibly damaging Het
Wdr31 G A 4: 62,462,205 A87V probably benign Het
Wwp2 A T 8: 107,485,596 T177S probably benign Het
Zfp28 T C 7: 6,394,638 C691R probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R7981:Agbl1 UTSW 7 76444840 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
R8406:Agbl1 UTSW 7 76418667 missense
R8432:Agbl1 UTSW 7 77124686 missense unknown
R8830:Agbl1 UTSW 7 76335311 missense
R8985:Agbl1 UTSW 7 76320156 missense
R9113:Agbl1 UTSW 7 76589477 missense unknown
R9170:Agbl1 UTSW 7 76335321 missense
R9229:Agbl1 UTSW 7 77124522 missense unknown
R9255:Agbl1 UTSW 7 76766402 missense unknown
R9391:Agbl1 UTSW 7 76421854 missense unknown
R9646:Agbl1 UTSW 7 76425900 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATCACAGCCCGAGTTCAC -3'
(R):5'- CAAATGAAGCACTGGACTAGGTTAG -3'

Sequencing Primer
(F):5'- TTCACCCAGGAGAGAGCAATGC -3'
(R):5'- CCATGAGACATACAAATATGCATGG -3'
Posted On 2021-08-30