Incidental Mutation 'R8899:Sh3bp4'
ID 679809
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 89070415-89155068 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89145575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 715 (T715I)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably benign
Transcript: ENSMUST00000066279
AA Change: T715I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: T715I

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,988,280 I2805T probably damaging Het
Agxt2 A T 15: 10,378,814 N167I probably damaging Het
Arel1 A G 12: 84,934,243 I330T probably benign Het
Ate1 T C 7: 130,394,659 K484E possibly damaging Het
Atl2 T C 17: 79,876,040 D42G probably benign Het
Cd209e C T 8: 3,851,212 W147* probably null Het
Cdc40 G A 10: 40,841,813 Q365* probably null Het
Cenpe A G 3: 135,239,883 T1053A probably benign Het
Colgalt1 T C 8: 71,623,662 S586P probably damaging Het
Crem A G 18: 3,295,370 I91T probably damaging Het
Csrnp3 G A 2: 66,022,643 V460I possibly damaging Het
Cul1 T A 6: 47,497,312 I136N possibly damaging Het
Ddx19b A T 8: 111,011,297 I273N probably damaging Het
Fap A G 2: 62,518,473 I505T probably damaging Het
Fbxo44 A T 4: 148,153,621 Y216* probably null Het
Fbxw10 T A 11: 62,857,741 M398K probably damaging Het
Fut10 T C 8: 31,236,486 V423A possibly damaging Het
Fyco1 A C 9: 123,826,581 D1037E probably benign Het
Gabrg2 G A 11: 41,976,550 R81* probably null Het
Gcn1l1 T C 5: 115,579,161 V204A probably benign Het
Gm5615 A T 9: 36,534,958 C53S probably damaging Het
Gnl1 T C 17: 35,988,716 L593P probably damaging Het
Grm4 T C 17: 27,434,780 Q732R probably damaging Het
Icam5 T C 9: 21,037,119 V741A possibly damaging Het
Iqub C T 6: 24,505,769 E47K probably benign Het
Kcnk3 A G 5: 30,622,236 K210R probably benign Het
Kdm2b T A 5: 122,987,788 R12* probably null Het
Kif1bp T C 10: 62,563,503 probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lgi1 C T 19: 38,306,090 H413Y probably damaging Het
Lhx8 A G 3: 154,328,016 Y51H probably damaging Het
Lim2 T C 7: 43,433,631 I80T probably benign Het
Macf1 A G 4: 123,475,059 F405L probably benign Het
Mefv G A 16: 3,710,900 T559I probably damaging Het
Nin A G 12: 70,030,936 W1739R probably damaging Het
Olfr1101 A G 2: 86,988,366 I270T probably benign Het
Olfr239 A T 17: 33,199,744 K232M probably damaging Het
Olfr736 T C 14: 50,392,812 F19L probably damaging Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Otop3 T C 11: 115,341,060 probably null Het
Pip5kl1 A G 2: 32,579,070 I247V probably benign Het
Polr2d T A 18: 31,789,173 M1K probably null Het
Prss53 T C 7: 127,889,021 T141A possibly damaging Het
Rdh12 A G 12: 79,222,028 N293S probably benign Het
Rnf146 G A 10: 29,347,758 T44I probably benign Het
Rsbn1l A T 5: 20,896,867 C588S probably damaging Het
Sept8 G A 11: 53,536,035 V208I probably damaging Het
Sgo2a T G 1: 58,019,663 S1134A possibly damaging Het
Snrnp200 A G 2: 127,236,597 T1758A probably damaging Het
Snx6 A T 12: 54,765,638 D70E probably benign Het
Spag9 T C 11: 94,092,869 S341P probably damaging Het
Sparcl1 T C 5: 104,092,724 D278G probably benign Het
Srbd1 T A 17: 85,985,457 S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tas2r136 T C 6: 132,777,360 D268G probably benign Het
Tas2r143 T A 6: 42,400,954 Y239* probably null Het
Tbc1d17 C T 7: 44,842,904 G419D probably damaging Het
Tff2 C T 17: 31,143,139 W68* probably null Het
Thegl T A 5: 77,037,353 probably null Het
Thop1 T C 10: 81,080,606 C483R probably damaging Het
Tmem245 A C 4: 56,903,916 probably null Het
Tmem67 A G 4: 12,055,038 F655S probably damaging Het
Trim36 T G 18: 46,169,197 S583R possibly damaging Het
Ucp1 T C 8: 83,290,587 V2A probably benign Het
Ugt1a6a T A 1: 88,139,081 M203K probably damaging Het
Usp1 A G 4: 98,931,110 K270E probably damaging Het
Vps13c T C 9: 67,934,501 F1935S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp799 G T 17: 32,820,374 P306Q probably damaging Het
Zfp831 A T 2: 174,644,185 R218W probably damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89143960 missense probably benign
IGL01344:Sh3bp4 APN 1 89153236 missense probably benign
IGL02025:Sh3bp4 APN 1 89145286 missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89143690 missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89145148 missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89153163 missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89143544 splice site probably benign
IGL03327:Sh3bp4 APN 1 89144163 nonsense probably null
I0000:Sh3bp4 UTSW 1 89137796 missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89145434 missense probably benign
R0128:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89143772 missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89145488 missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89145592 missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89145328 missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89145869 missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89144273 missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89145595 missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89144240 missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89137734 missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89144275 missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89145350 missense probably benign
R5908:Sh3bp4 UTSW 1 89145883 missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89145489 missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89144921 missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89153166 missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89145767 missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89153102 splice site probably null
R7320:Sh3bp4 UTSW 1 89145494 missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89144448 missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89145646 missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89145315 missense probably benign 0.00
R8915:Sh3bp4 UTSW 1 89152342 missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89144437 missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89144925 nonsense probably null
R9718:Sh3bp4 UTSW 1 89145750 missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89145022 missense probably benign
Z1176:Sh3bp4 UTSW 1 89145728 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCAAGTATCCAACGTTTCAGGAC -3'
(R):5'- GTAACCCAGGGCATCAGCAAAG -3'

Sequencing Primer
(F):5'- CCTCAAGTTTGGCAAGCTTCTAAAG -3'
(R):5'- GCATCAGCAAAGGCCCG -3'
Posted On 2021-08-31