Incidental Mutation 'R8899:Cenpe'
ID 679817
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135212537-135273611 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135239883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1053 (T1053A)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: T1053A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: T1053A

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,988,280 I2805T probably damaging Het
Agxt2 A T 15: 10,378,814 N167I probably damaging Het
Arel1 A G 12: 84,934,243 I330T probably benign Het
Ate1 T C 7: 130,394,659 K484E possibly damaging Het
Atl2 T C 17: 79,876,040 D42G probably benign Het
Cd209e C T 8: 3,851,212 W147* probably null Het
Cdc40 G A 10: 40,841,813 Q365* probably null Het
Colgalt1 T C 8: 71,623,662 S586P probably damaging Het
Crem A G 18: 3,295,370 I91T probably damaging Het
Csrnp3 G A 2: 66,022,643 V460I possibly damaging Het
Cul1 T A 6: 47,497,312 I136N possibly damaging Het
Ddx19b A T 8: 111,011,297 I273N probably damaging Het
Fap A G 2: 62,518,473 I505T probably damaging Het
Fbxo44 A T 4: 148,153,621 Y216* probably null Het
Fbxw10 T A 11: 62,857,741 M398K probably damaging Het
Fut10 T C 8: 31,236,486 V423A possibly damaging Het
Fyco1 A C 9: 123,826,581 D1037E probably benign Het
Gabrg2 G A 11: 41,976,550 R81* probably null Het
Gcn1l1 T C 5: 115,579,161 V204A probably benign Het
Gm5615 A T 9: 36,534,958 C53S probably damaging Het
Gnl1 T C 17: 35,988,716 L593P probably damaging Het
Grm4 T C 17: 27,434,780 Q732R probably damaging Het
Icam5 T C 9: 21,037,119 V741A possibly damaging Het
Iqub C T 6: 24,505,769 E47K probably benign Het
Kcnk3 A G 5: 30,622,236 K210R probably benign Het
Kdm2b T A 5: 122,987,788 R12* probably null Het
Kif1bp T C 10: 62,563,503 probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lgi1 C T 19: 38,306,090 H413Y probably damaging Het
Lhx8 A G 3: 154,328,016 Y51H probably damaging Het
Lim2 T C 7: 43,433,631 I80T probably benign Het
Macf1 A G 4: 123,475,059 F405L probably benign Het
Mefv G A 16: 3,710,900 T559I probably damaging Het
Nin A G 12: 70,030,936 W1739R probably damaging Het
Olfr1101 A G 2: 86,988,366 I270T probably benign Het
Olfr239 A T 17: 33,199,744 K232M probably damaging Het
Olfr736 T C 14: 50,392,812 F19L probably damaging Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Otop3 T C 11: 115,341,060 probably null Het
Pip5kl1 A G 2: 32,579,070 I247V probably benign Het
Polr2d T A 18: 31,789,173 M1K probably null Het
Prss53 T C 7: 127,889,021 T141A possibly damaging Het
Rdh12 A G 12: 79,222,028 N293S probably benign Het
Rnf146 G A 10: 29,347,758 T44I probably benign Het
Rsbn1l A T 5: 20,896,867 C588S probably damaging Het
Sept8 G A 11: 53,536,035 V208I probably damaging Het
Sgo2a T G 1: 58,019,663 S1134A possibly damaging Het
Sh3bp4 C T 1: 89,145,575 T715I probably benign Het
Snrnp200 A G 2: 127,236,597 T1758A probably damaging Het
Snx6 A T 12: 54,765,638 D70E probably benign Het
Spag9 T C 11: 94,092,869 S341P probably damaging Het
Sparcl1 T C 5: 104,092,724 D278G probably benign Het
Srbd1 T A 17: 85,985,457 S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tas2r136 T C 6: 132,777,360 D268G probably benign Het
Tas2r143 T A 6: 42,400,954 Y239* probably null Het
Tbc1d17 C T 7: 44,842,904 G419D probably damaging Het
Tff2 C T 17: 31,143,139 W68* probably null Het
Thegl T A 5: 77,037,353 probably null Het
Thop1 T C 10: 81,080,606 C483R probably damaging Het
Tmem245 A C 4: 56,903,916 probably null Het
Tmem67 A G 4: 12,055,038 F655S probably damaging Het
Trim36 T G 18: 46,169,197 S583R possibly damaging Het
Ucp1 T C 8: 83,290,587 V2A probably benign Het
Ugt1a6a T A 1: 88,139,081 M203K probably damaging Het
Usp1 A G 4: 98,931,110 K270E probably damaging Het
Vps13c T C 9: 67,934,501 F1935S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp799 G T 17: 32,820,374 P306Q probably damaging Het
Zfp831 A T 2: 174,644,185 R218W probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7973:Cenpe UTSW 3 135223250 missense probably damaging 1.00
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
R8425:Cenpe UTSW 3 135242627 nonsense probably null
R8488:Cenpe UTSW 3 135259241 missense probably damaging 1.00
R8811:Cenpe UTSW 3 135223240 missense probably damaging 1.00
R8850:Cenpe UTSW 3 135225016 missense probably damaging 1.00
R8879:Cenpe UTSW 3 135260101 missense probably damaging 0.99
R9035:Cenpe UTSW 3 135270811 missense probably benign 0.01
R9038:Cenpe UTSW 3 135218036 missense probably benign 0.00
R9093:Cenpe UTSW 3 135239880 nonsense probably null
R9221:Cenpe UTSW 3 135230078 missense possibly damaging 0.90
R9365:Cenpe UTSW 3 135248446 missense possibly damaging 0.56
R9443:Cenpe UTSW 3 135270848 missense probably damaging 0.99
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCCAGTGAACAG -3'
(R):5'- AGTTCTAACTTAGGCAGAGACATCTG -3'

Sequencing Primer
(F):5'- GAACCCAAAGCTAGCTGTCTGTATG -3'
(R):5'- GACATCTGTCAAGTCATATAACCATC -3'
Posted On 2021-08-31