Incidental Mutation 'R8899:Kndc1'
ID 679838
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139927795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1222 (S1222F)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: S1222F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S1222F

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,988,280 I2805T probably damaging Het
Agxt2 A T 15: 10,378,814 N167I probably damaging Het
Arel1 A G 12: 84,934,243 I330T probably benign Het
Ate1 T C 7: 130,394,659 K484E possibly damaging Het
Atl2 T C 17: 79,876,040 D42G probably benign Het
Cd209e C T 8: 3,851,212 W147* probably null Het
Cdc40 G A 10: 40,841,813 Q365* probably null Het
Cenpe A G 3: 135,239,883 T1053A probably benign Het
Colgalt1 T C 8: 71,623,662 S586P probably damaging Het
Crem A G 18: 3,295,370 I91T probably damaging Het
Csrnp3 G A 2: 66,022,643 V460I possibly damaging Het
Cul1 T A 6: 47,497,312 I136N possibly damaging Het
Ddx19b A T 8: 111,011,297 I273N probably damaging Het
Fap A G 2: 62,518,473 I505T probably damaging Het
Fbxo44 A T 4: 148,153,621 Y216* probably null Het
Fbxw10 T A 11: 62,857,741 M398K probably damaging Het
Fut10 T C 8: 31,236,486 V423A possibly damaging Het
Fyco1 A C 9: 123,826,581 D1037E probably benign Het
Gabrg2 G A 11: 41,976,550 R81* probably null Het
Gcn1l1 T C 5: 115,579,161 V204A probably benign Het
Gm5615 A T 9: 36,534,958 C53S probably damaging Het
Gnl1 T C 17: 35,988,716 L593P probably damaging Het
Grm4 T C 17: 27,434,780 Q732R probably damaging Het
Icam5 T C 9: 21,037,119 V741A possibly damaging Het
Iqub C T 6: 24,505,769 E47K probably benign Het
Kcnk3 A G 5: 30,622,236 K210R probably benign Het
Kdm2b T A 5: 122,987,788 R12* probably null Het
Kif1bp T C 10: 62,563,503 probably benign Het
Lgi1 C T 19: 38,306,090 H413Y probably damaging Het
Lhx8 A G 3: 154,328,016 Y51H probably damaging Het
Lim2 T C 7: 43,433,631 I80T probably benign Het
Macf1 A G 4: 123,475,059 F405L probably benign Het
Mefv G A 16: 3,710,900 T559I probably damaging Het
Nin A G 12: 70,030,936 W1739R probably damaging Het
Olfr1101 A G 2: 86,988,366 I270T probably benign Het
Olfr239 A T 17: 33,199,744 K232M probably damaging Het
Olfr736 T C 14: 50,392,812 F19L probably damaging Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Otop3 T C 11: 115,341,060 probably null Het
Pip5kl1 A G 2: 32,579,070 I247V probably benign Het
Polr2d T A 18: 31,789,173 M1K probably null Het
Prss53 T C 7: 127,889,021 T141A possibly damaging Het
Rdh12 A G 12: 79,222,028 N293S probably benign Het
Rnf146 G A 10: 29,347,758 T44I probably benign Het
Rsbn1l A T 5: 20,896,867 C588S probably damaging Het
Sept8 G A 11: 53,536,035 V208I probably damaging Het
Sgo2a T G 1: 58,019,663 S1134A possibly damaging Het
Sh3bp4 C T 1: 89,145,575 T715I probably benign Het
Snrnp200 A G 2: 127,236,597 T1758A probably damaging Het
Snx6 A T 12: 54,765,638 D70E probably benign Het
Spag9 T C 11: 94,092,869 S341P probably damaging Het
Sparcl1 T C 5: 104,092,724 D278G probably benign Het
Srbd1 T A 17: 85,985,457 S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tas2r136 T C 6: 132,777,360 D268G probably benign Het
Tas2r143 T A 6: 42,400,954 Y239* probably null Het
Tbc1d17 C T 7: 44,842,904 G419D probably damaging Het
Tff2 C T 17: 31,143,139 W68* probably null Het
Thegl T A 5: 77,037,353 probably null Het
Thop1 T C 10: 81,080,606 C483R probably damaging Het
Tmem245 A C 4: 56,903,916 probably null Het
Tmem67 A G 4: 12,055,038 F655S probably damaging Het
Trim36 T G 18: 46,169,197 S583R possibly damaging Het
Ucp1 T C 8: 83,290,587 V2A probably benign Het
Ugt1a6a T A 1: 88,139,081 M203K probably damaging Het
Usp1 A G 4: 98,931,110 K270E probably damaging Het
Vps13c T C 9: 67,934,501 F1935S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp799 G T 17: 32,820,374 P306Q probably damaging Het
Zfp831 A T 2: 174,644,185 R218W probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGGGTCAATAGCAAAGTGAC -3'
(R):5'- TTGCATAACCCATGTCAGACAG -3'

Sequencing Primer
(F):5'- GTCAATAGCAAAGTGACCCATAG -3'
(R):5'- ATGTCAGACAGAGCTTTCCTTG -3'
Posted On 2021-08-31