Incidental Mutation 'R8899:Kndc1'
ID 679838
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 068756-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139507708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1222 (S1222F)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: S1222F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S1222F

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,900 (GRCm39) N167I probably damaging Het
Arel1 A G 12: 84,981,017 (GRCm39) I330T probably benign Het
Ate1 T C 7: 129,996,389 (GRCm39) K484E possibly damaging Het
Atl2 T C 17: 80,183,469 (GRCm39) D42G probably benign Het
Bltp1 T C 3: 37,042,429 (GRCm39) I2805T probably damaging Het
Cd209e C T 8: 3,901,212 (GRCm39) W147* probably null Het
Cdc40 G A 10: 40,717,809 (GRCm39) Q365* probably null Het
Cenpe A G 3: 134,945,644 (GRCm39) T1053A probably benign Het
Colgalt1 T C 8: 72,076,306 (GRCm39) S586P probably damaging Het
Crem A G 18: 3,295,370 (GRCm39) I91T probably damaging Het
Csrnp3 G A 2: 65,852,987 (GRCm39) V460I possibly damaging Het
Cul1 T A 6: 47,474,246 (GRCm39) I136N possibly damaging Het
Ddx19b A T 8: 111,737,929 (GRCm39) I273N probably damaging Het
Fap A G 2: 62,348,817 (GRCm39) I505T probably damaging Het
Fbxo44 A T 4: 148,238,078 (GRCm39) Y216* probably null Het
Fbxw10 T A 11: 62,748,567 (GRCm39) M398K probably damaging Het
Fut10 T C 8: 31,726,514 (GRCm39) V423A possibly damaging Het
Fyco1 A C 9: 123,655,646 (GRCm39) D1037E probably benign Het
Gabrg2 G A 11: 41,867,377 (GRCm39) R81* probably null Het
Gcn1 T C 5: 115,717,220 (GRCm39) V204A probably benign Het
Gnl1 T C 17: 36,299,608 (GRCm39) L593P probably damaging Het
Grm4 T C 17: 27,653,754 (GRCm39) Q732R probably damaging Het
Icam5 T C 9: 20,948,415 (GRCm39) V741A possibly damaging Het
Iqub C T 6: 24,505,768 (GRCm39) E47K probably benign Het
Kcnk3 A G 5: 30,779,580 (GRCm39) K210R probably benign Het
Kdm2b T A 5: 123,125,851 (GRCm39) R12* probably null Het
Kifbp T C 10: 62,399,282 (GRCm39) probably benign Het
Lgi1 C T 19: 38,294,538 (GRCm39) H413Y probably damaging Het
Lhx8 A G 3: 154,033,653 (GRCm39) Y51H probably damaging Het
Lim2 T C 7: 43,083,055 (GRCm39) I80T probably benign Het
Macf1 A G 4: 123,368,852 (GRCm39) F405L probably benign Het
Mefv G A 16: 3,528,764 (GRCm39) T559I probably damaging Het
Nin A G 12: 70,077,710 (GRCm39) W1739R probably damaging Het
Or10h1 A T 17: 33,418,718 (GRCm39) K232M probably damaging Het
Or11j4 T C 14: 50,630,269 (GRCm39) F19L probably damaging Het
Or5t16 A G 2: 86,818,710 (GRCm39) I270T probably benign Het
Or8b3b C T 9: 38,584,147 (GRCm39) V198I probably damaging Het
Otop3 T C 11: 115,231,886 (GRCm39) probably null Het
Pate9 A T 9: 36,446,254 (GRCm39) C53S probably damaging Het
Pip5kl1 A G 2: 32,469,082 (GRCm39) I247V probably benign Het
Polr2d T A 18: 31,922,226 (GRCm39) M1K probably null Het
Prss53 T C 7: 127,488,193 (GRCm39) T141A possibly damaging Het
Rdh12 A G 12: 79,268,802 (GRCm39) N293S probably benign Het
Rnf146 G A 10: 29,223,754 (GRCm39) T44I probably benign Het
Rsbn1l A T 5: 21,101,865 (GRCm39) C588S probably damaging Het
Septin8 G A 11: 53,426,862 (GRCm39) V208I probably damaging Het
Sgo2a T G 1: 58,058,822 (GRCm39) S1134A possibly damaging Het
Sh3bp4 C T 1: 89,073,297 (GRCm39) T715I probably benign Het
Snrnp200 A G 2: 127,078,517 (GRCm39) T1758A probably damaging Het
Snx6 A T 12: 54,812,423 (GRCm39) D70E probably benign Het
Spag9 T C 11: 93,983,695 (GRCm39) S341P probably damaging Het
Sparcl1 T C 5: 104,240,590 (GRCm39) D278G probably benign Het
Spmap2l T A 5: 77,185,200 (GRCm39) probably null Het
Srbd1 T A 17: 86,292,885 (GRCm39) S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Tas2r136 T C 6: 132,754,323 (GRCm39) D268G probably benign Het
Tas2r143 T A 6: 42,377,888 (GRCm39) Y239* probably null Het
Tbc1d17 C T 7: 44,492,328 (GRCm39) G419D probably damaging Het
Tff2 C T 17: 31,362,113 (GRCm39) W68* probably null Het
Thop1 T C 10: 80,916,440 (GRCm39) C483R probably damaging Het
Tmem245 A C 4: 56,903,916 (GRCm39) probably null Het
Tmem67 A G 4: 12,055,038 (GRCm39) F655S probably damaging Het
Trim36 T G 18: 46,302,264 (GRCm39) S583R possibly damaging Het
Ucp1 T C 8: 84,017,216 (GRCm39) V2A probably benign Het
Ugt1a6a T A 1: 88,066,803 (GRCm39) M203K probably damaging Het
Usp1 A G 4: 98,819,347 (GRCm39) K270E probably damaging Het
Vps13c T C 9: 67,841,783 (GRCm39) F1935S probably damaging Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Zfp799 G T 17: 33,039,348 (GRCm39) P306Q probably damaging Het
Zfp831 A T 2: 174,485,978 (GRCm39) R218W probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGGGTCAATAGCAAAGTGAC -3'
(R):5'- TTGCATAACCCATGTCAGACAG -3'

Sequencing Primer
(F):5'- GTCAATAGCAAAGTGACCCATAG -3'
(R):5'- ATGTCAGACAGAGCTTTCCTTG -3'
Posted On 2021-08-31