Incidental Mutation 'R8900:Tmem132b'
ID 679898
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Name transmembrane protein 132B
Synonyms
MMRRC Submission 068757-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8900 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125609449-125869647 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125855884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 539 (I539F)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
AlphaFold F7BAB2
Predicted Effect probably damaging
Transcript: ENSMUST00000031446
AA Change: I539F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: I539F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,045,218 (GRCm39) T372A probably benign Het
Adamts8 C A 9: 30,865,930 (GRCm39) R493S probably benign Het
Ankrd33b G A 15: 31,297,830 (GRCm39) T309I probably damaging Het
Arhgap22 G A 14: 32,993,880 (GRCm39) W58* probably null Het
B4galt4 C T 16: 38,572,404 (GRCm39) probably benign Het
Bcl2a1a A T 9: 88,839,311 (GRCm39) I70L probably benign Het
Bst1 A G 5: 43,977,942 (GRCm39) D97G possibly damaging Het
Cand2 C T 6: 115,757,894 (GRCm39) T52M probably benign Het
Cd101 C A 3: 100,926,062 (GRCm39) R219L probably benign Het
Cd5l T A 3: 87,274,882 (GRCm39) D140E probably benign Het
Cdcp3 A T 7: 130,904,197 (GRCm39) probably benign Het
Cebpa A G 7: 34,819,906 (GRCm39) M355V possibly damaging Het
Cfap74 G A 4: 155,521,187 (GRCm39) E620K Het
Clec4a4 A G 6: 123,000,875 (GRCm39) E196G probably damaging Het
Cpxm1 T A 2: 130,235,360 (GRCm39) D544V probably damaging Het
Cwf19l2 T A 9: 3,447,245 (GRCm39) D535E probably benign Het
Daw1 T G 1: 83,175,898 (GRCm39) L212R probably benign Het
Dnm3 T A 1: 162,135,445 (GRCm39) T443S probably benign Het
Dock9 T C 14: 121,817,940 (GRCm39) D1627G probably damaging Het
Dohh A G 10: 81,223,735 (GRCm39) I263V probably benign Het
Dsp G A 13: 38,365,155 (GRCm39) V513M probably damaging Het
Dus4l G T 12: 31,690,692 (GRCm39) L320I possibly damaging Het
Edc4 A C 8: 106,617,857 (GRCm39) Q1139P probably damaging Het
Fam220a T A 5: 143,549,228 (GRCm39) C213* probably null Het
Fgf14 A T 14: 124,221,326 (GRCm39) Y159* probably null Het
Gm45861 A T 8: 28,019,632 (GRCm39) D749V unknown Het
Hip1 T C 5: 135,459,144 (GRCm39) T203A probably benign Het
Igfals A G 17: 25,099,014 (GRCm39) D35G possibly damaging Het
Itga4 T A 2: 79,145,332 (GRCm39) I716K probably damaging Het
Ncaph2 T A 15: 89,253,594 (GRCm39) I282N probably benign Het
Ndufb3 T C 1: 58,634,824 (GRCm39) Y59H probably damaging Het
Nxpe3 T C 16: 55,665,023 (GRCm39) H399R probably damaging Het
Nxph1 T C 6: 9,247,601 (GRCm39) S191P probably damaging Het
Or13c7e-ps1 G T 4: 43,781,432 (GRCm39) S299R probably benign Het
Or1p1 T C 11: 74,180,413 (GRCm39) S314P probably damaging Het
Pcdha11 T G 18: 37,145,799 (GRCm39) I630S probably damaging Het
Pfkl C G 10: 77,836,615 (GRCm39) G134A probably damaging Het
Phf19 A T 2: 34,795,484 (GRCm39) C196S probably damaging Het
Piezo2 T C 18: 63,248,096 (GRCm39) K468R probably benign Het
Plekhn1 T C 4: 156,310,078 (GRCm39) S79G possibly damaging Het
Pomk A G 8: 26,473,384 (GRCm39) Y190H possibly damaging Het
Ppp1r13b T A 12: 111,838,778 (GRCm39) E33D probably damaging Het
Raly A T 2: 154,705,493 (GRCm39) I174F probably damaging Het
Rint1 T C 5: 24,016,882 (GRCm39) V549A possibly damaging Het
Rnf31 T G 14: 55,833,689 (GRCm39) C566G probably damaging Het
Scart1 G A 7: 139,808,478 (GRCm39) W796* probably null Het
Sdc1 C T 12: 8,840,460 (GRCm39) T79I possibly damaging Het
Sema6a T G 18: 47,424,182 (GRCm39) E242A probably damaging Het
Slc22a30 A C 19: 8,315,340 (GRCm39) M430R probably damaging Het
Sp9 C A 2: 73,103,863 (GRCm39) T139K probably benign Het
Tbkbp1 T C 11: 97,040,327 (GRCm39) D29G probably benign Het
Tcf4 T C 18: 69,697,761 (GRCm39) probably benign Het
Tenm3 A T 8: 48,689,437 (GRCm39) I2050N probably damaging Het
Tiparp T A 3: 65,460,603 (GRCm39) F531I probably damaging Het
Ttf2 T C 3: 100,859,956 (GRCm39) D666G probably damaging Het
Vmn1r51 T C 6: 90,106,842 (GRCm39) S253P probably damaging Het
Vmn2r104 A G 17: 20,261,924 (GRCm39) I402T probably damaging Het
Vmn2r16 T C 5: 109,511,619 (GRCm39) Y609H probably benign Het
Vmn2r17 A T 5: 109,575,863 (GRCm39) M245L probably benign Het
Vmn2r42 C T 7: 8,197,792 (GRCm39) E276K probably benign Het
Wdr75 C A 1: 45,838,287 (GRCm39) N65K probably damaging Het
Zbtb47 A C 9: 121,596,705 (GRCm39) K687T probably damaging Het
Zfhx4 T C 3: 5,463,924 (GRCm39) S1361P probably damaging Het
Zfp317 T A 9: 19,558,708 (GRCm39) C396* probably null Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125,775,792 (GRCm39) missense probably benign
IGL01518:Tmem132b APN 5 125,855,855 (GRCm39) missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125,699,558 (GRCm39) missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125,864,639 (GRCm39) missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125,855,791 (GRCm39) missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125,864,611 (GRCm39) missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125,864,788 (GRCm39) missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125,862,990 (GRCm39) missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125,860,485 (GRCm39) missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125,860,606 (GRCm39) missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125,864,083 (GRCm39) missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125,715,313 (GRCm39) missense probably benign 0.01
R1689:Tmem132b UTSW 5 125,864,678 (GRCm39) missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125,855,908 (GRCm39) critical splice donor site probably null
R1835:Tmem132b UTSW 5 125,862,963 (GRCm39) missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125,700,080 (GRCm39) missense probably benign
R2033:Tmem132b UTSW 5 125,826,353 (GRCm39) missense probably damaging 0.98
R2097:Tmem132b UTSW 5 125,715,272 (GRCm39) missense probably damaging 0.99
R2114:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R3807:Tmem132b UTSW 5 125,864,644 (GRCm39) missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125,860,497 (GRCm39) missense probably benign
R5149:Tmem132b UTSW 5 125,699,989 (GRCm39) missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125,864,797 (GRCm39) missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125,700,416 (GRCm39) missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125,699,710 (GRCm39) missense probably benign 0.04
R5775:Tmem132b UTSW 5 125,715,394 (GRCm39) critical splice donor site probably null
R7012:Tmem132b UTSW 5 125,775,654 (GRCm39) missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125,699,737 (GRCm39) missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125,864,710 (GRCm39) missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125,864,555 (GRCm39) missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R7650:Tmem132b UTSW 5 125,864,074 (GRCm39) missense probably benign 0.04
R8111:Tmem132b UTSW 5 125,699,857 (GRCm39) missense probably benign 0.00
R8326:Tmem132b UTSW 5 125,864,618 (GRCm39) missense probably damaging 1.00
R8525:Tmem132b UTSW 5 125,715,380 (GRCm39) missense probably benign 0.01
R9147:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9148:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9179:Tmem132b UTSW 5 125,700,115 (GRCm39) missense probably benign 0.02
R9215:Tmem132b UTSW 5 125,864,180 (GRCm39) missense probably damaging 0.99
R9231:Tmem132b UTSW 5 125,860,531 (GRCm39) missense probably damaging 1.00
R9284:Tmem132b UTSW 5 125,864,711 (GRCm39) missense possibly damaging 0.67
R9311:Tmem132b UTSW 5 125,863,029 (GRCm39) missense possibly damaging 0.56
R9436:Tmem132b UTSW 5 125,775,633 (GRCm39) missense possibly damaging 0.53
R9484:Tmem132b UTSW 5 125,860,420 (GRCm39) missense probably damaging 0.98
R9775:Tmem132b UTSW 5 125,864,566 (GRCm39) missense probably benign 0.07
Z1176:Tmem132b UTSW 5 125,864,950 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TCTACAGATGTCGAGCTCCG -3'
(R):5'- TCATCCAAGTCAGGTCCACAG -3'

Sequencing Primer
(F):5'- AAGGTCTCCAACACCTGTGATTC -3'
(R):5'- GTCAGGTCCACAGGAACCC -3'
Posted On 2021-08-31