Incidental Mutation 'R8900:Bcl2a1a'
ID 679916
Institutional Source Beutler Lab
Gene Symbol Bcl2a1a
Ensembl Gene ENSMUSG00000102037
Gene Name B cell leukemia/lymphoma 2 related protein A1a
Synonyms A1, Hbpa1, Bcl2a1, Bfl-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8900 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 88956900-88962419 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88957258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 70 (I70L)
Ref Sequence ENSEMBL: ENSMUSP00000096086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098485]
AlphaFold Q07440
PDB Structure STRUCTURE OF MOUSE A1 BOUND TO THE PUMA BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BMF BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BAK BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BID BH3-DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000098485
AA Change: I70L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096086
Gene: ENSMUSG00000102037
AA Change: I70L

DomainStartEndE-ValueType
BCL 37 140 2.45e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Homozygous null mutants show enhanced spontaneous apoptosis of neutrophils, while both heterozygous and homozygous null mutants lack LPS-induced neutrophil apoptosis inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,302,468 probably benign Het
Abca9 T C 11: 110,154,392 T372A probably benign Het
Adamts8 C A 9: 30,954,634 R493S probably benign Het
Ankrd33b G A 15: 31,297,684 T309I probably damaging Het
Arhgap22 G A 14: 33,271,923 W58* probably null Het
B4galt4 C T 16: 38,752,042 probably benign Het
Bst1 A G 5: 43,820,600 D97G possibly damaging Het
Cand2 C T 6: 115,780,933 T52M probably benign Het
Cd101 C A 3: 101,018,746 R219L probably benign Het
Cd163l1 G A 7: 140,228,565 W796* probably null Het
Cd5l T A 3: 87,367,575 D140E probably benign Het
Cebpa A G 7: 35,120,481 M355V possibly damaging Het
Cfap74 G A 4: 155,436,730 E620K Het
Clec4a4 A G 6: 123,023,916 E196G probably damaging Het
Cpxm1 T A 2: 130,393,440 D544V probably damaging Het
Cwf19l2 T A 9: 3,447,245 D535E probably benign Het
Daw1 T G 1: 83,198,177 L212R probably benign Het
Dnm3 T A 1: 162,307,876 T443S probably benign Het
Dock9 T C 14: 121,580,528 D1627G probably damaging Het
Dohh A G 10: 81,387,901 I263V probably benign Het
Dsp G A 13: 38,181,179 V513M probably damaging Het
Dus4l G T 12: 31,640,693 L320I possibly damaging Het
Edc4 A C 8: 105,891,225 Q1139P probably damaging Het
Fam220a T A 5: 143,563,473 C213* probably null Het
Fgf14 A T 14: 123,983,914 Y159* probably null Het
Gm45861 A T 8: 27,529,604 D749V unknown Het
Hip1 T C 5: 135,430,290 T203A probably benign Het
Igfals A G 17: 24,880,040 D35G possibly damaging Het
Itga4 T A 2: 79,314,988 I716K probably damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Ndufb3 T C 1: 58,595,665 Y59H probably damaging Het
Nxpe3 T C 16: 55,844,660 H399R probably damaging Het
Nxph1 T C 6: 9,247,601 S191P probably damaging Het
Olfr29-ps1 G T 4: 43,781,432 S299R probably benign Het
Olfr59 T C 11: 74,289,587 S314P probably damaging Het
Pcdha11 T G 18: 37,012,746 I630S probably damaging Het
Pfkl C G 10: 78,000,781 G134A probably damaging Het
Phf19 A T 2: 34,905,472 C196S probably damaging Het
Piezo2 T C 18: 63,115,025 K468R probably benign Het
Plekhn1 T C 4: 156,225,621 S79G possibly damaging Het
Pomk A G 8: 25,983,356 Y190H possibly damaging Het
Ppp1r13b T A 12: 111,872,344 E33D probably damaging Het
Raly A T 2: 154,863,573 I174F probably damaging Het
Rint1 T C 5: 23,811,884 V549A possibly damaging Het
Rnf31 T G 14: 55,596,232 C566G probably damaging Het
Sdc1 C T 12: 8,790,460 T79I possibly damaging Het
Sema6a T G 18: 47,291,115 E242A probably damaging Het
Slc22a30 A C 19: 8,337,976 M430R probably damaging Het
Sp9 C A 2: 73,273,519 T139K probably benign Het
Tbkbp1 T C 11: 97,149,501 D29G probably benign Het
Tcf4 T C 18: 69,564,690 probably benign Het
Tenm3 A T 8: 48,236,402 I2050N probably damaging Het
Tiparp T A 3: 65,553,182 F531I probably damaging Het
Tmem132b A T 5: 125,778,820 I539F probably damaging Het
Ttf2 T C 3: 100,952,640 D666G probably damaging Het
Vmn1r51 T C 6: 90,129,860 S253P probably damaging Het
Vmn2r104 A G 17: 20,041,662 I402T probably damaging Het
Vmn2r16 T C 5: 109,363,753 Y609H probably benign Het
Vmn2r17 A T 5: 109,427,997 M245L probably benign Het
Vmn2r42 C T 7: 8,194,793 E276K probably benign Het
Wdr75 C A 1: 45,799,127 N65K probably damaging Het
Zfhx4 T C 3: 5,398,864 S1361P probably damaging Het
Zfp317 T A 9: 19,647,412 C396* probably null Het
Zfp651 A C 9: 121,767,639 K687T probably damaging Het
Other mutations in Bcl2a1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Bcl2a1a APN 9 88957447 missense probably damaging 1.00
IGL02942:Bcl2a1a APN 9 88957042 utr 5 prime probably benign
R0064:Bcl2a1a UTSW 9 88957463 missense probably damaging 1.00
R1672:Bcl2a1a UTSW 9 88957450 missense probably damaging 1.00
R2511:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4616:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4618:Bcl2a1a UTSW 9 88957304 missense probably damaging 1.00
R4947:Bcl2a1a UTSW 9 88957282 missense probably damaging 1.00
R7584:Bcl2a1a UTSW 9 88957292 missense probably damaging 1.00
R8867:Bcl2a1a UTSW 9 88957450 missense probably damaging 1.00
R9685:Bcl2a1a UTSW 9 88957132 missense probably benign 0.00
Z1177:Bcl2a1a UTSW 9 88957466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGACAAGACCTATCTTTGC -3'
(R):5'- TGAATTCTGCCACAAAACTGG -3'

Sequencing Primer
(F):5'- GAGTCTGAGCTCATGCATATCCAC -3'
(R):5'- CTGCCACAAAACTGGAAACTTGTTTG -3'
Posted On 2021-08-31