Incidental Mutation 'R8900:Dock9'
ID 679929
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 068757-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8900 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121817940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1627 (D1627G)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: D1636G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: D1636G

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: D1607G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: D1607G

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: D1637G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: D1627G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Meta Mutation Damage Score 0.2758 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,045,218 (GRCm39) T372A probably benign Het
Adamts8 C A 9: 30,865,930 (GRCm39) R493S probably benign Het
Ankrd33b G A 15: 31,297,830 (GRCm39) T309I probably damaging Het
Arhgap22 G A 14: 32,993,880 (GRCm39) W58* probably null Het
B4galt4 C T 16: 38,572,404 (GRCm39) probably benign Het
Bcl2a1a A T 9: 88,839,311 (GRCm39) I70L probably benign Het
Bst1 A G 5: 43,977,942 (GRCm39) D97G possibly damaging Het
Cand2 C T 6: 115,757,894 (GRCm39) T52M probably benign Het
Cd101 C A 3: 100,926,062 (GRCm39) R219L probably benign Het
Cd5l T A 3: 87,274,882 (GRCm39) D140E probably benign Het
Cdcp3 A T 7: 130,904,197 (GRCm39) probably benign Het
Cebpa A G 7: 34,819,906 (GRCm39) M355V possibly damaging Het
Cfap74 G A 4: 155,521,187 (GRCm39) E620K Het
Clec4a4 A G 6: 123,000,875 (GRCm39) E196G probably damaging Het
Cpxm1 T A 2: 130,235,360 (GRCm39) D544V probably damaging Het
Cwf19l2 T A 9: 3,447,245 (GRCm39) D535E probably benign Het
Daw1 T G 1: 83,175,898 (GRCm39) L212R probably benign Het
Dnm3 T A 1: 162,135,445 (GRCm39) T443S probably benign Het
Dohh A G 10: 81,223,735 (GRCm39) I263V probably benign Het
Dsp G A 13: 38,365,155 (GRCm39) V513M probably damaging Het
Dus4l G T 12: 31,690,692 (GRCm39) L320I possibly damaging Het
Edc4 A C 8: 106,617,857 (GRCm39) Q1139P probably damaging Het
Fam220a T A 5: 143,549,228 (GRCm39) C213* probably null Het
Fgf14 A T 14: 124,221,326 (GRCm39) Y159* probably null Het
Gm45861 A T 8: 28,019,632 (GRCm39) D749V unknown Het
Hip1 T C 5: 135,459,144 (GRCm39) T203A probably benign Het
Igfals A G 17: 25,099,014 (GRCm39) D35G possibly damaging Het
Itga4 T A 2: 79,145,332 (GRCm39) I716K probably damaging Het
Ncaph2 T A 15: 89,253,594 (GRCm39) I282N probably benign Het
Ndufb3 T C 1: 58,634,824 (GRCm39) Y59H probably damaging Het
Nxpe3 T C 16: 55,665,023 (GRCm39) H399R probably damaging Het
Nxph1 T C 6: 9,247,601 (GRCm39) S191P probably damaging Het
Or13c7e-ps1 G T 4: 43,781,432 (GRCm39) S299R probably benign Het
Or1p1 T C 11: 74,180,413 (GRCm39) S314P probably damaging Het
Pcdha11 T G 18: 37,145,799 (GRCm39) I630S probably damaging Het
Pfkl C G 10: 77,836,615 (GRCm39) G134A probably damaging Het
Phf19 A T 2: 34,795,484 (GRCm39) C196S probably damaging Het
Piezo2 T C 18: 63,248,096 (GRCm39) K468R probably benign Het
Plekhn1 T C 4: 156,310,078 (GRCm39) S79G possibly damaging Het
Pomk A G 8: 26,473,384 (GRCm39) Y190H possibly damaging Het
Ppp1r13b T A 12: 111,838,778 (GRCm39) E33D probably damaging Het
Raly A T 2: 154,705,493 (GRCm39) I174F probably damaging Het
Rint1 T C 5: 24,016,882 (GRCm39) V549A possibly damaging Het
Rnf31 T G 14: 55,833,689 (GRCm39) C566G probably damaging Het
Scart1 G A 7: 139,808,478 (GRCm39) W796* probably null Het
Sdc1 C T 12: 8,840,460 (GRCm39) T79I possibly damaging Het
Sema6a T G 18: 47,424,182 (GRCm39) E242A probably damaging Het
Slc22a30 A C 19: 8,315,340 (GRCm39) M430R probably damaging Het
Sp9 C A 2: 73,103,863 (GRCm39) T139K probably benign Het
Tbkbp1 T C 11: 97,040,327 (GRCm39) D29G probably benign Het
Tcf4 T C 18: 69,697,761 (GRCm39) probably benign Het
Tenm3 A T 8: 48,689,437 (GRCm39) I2050N probably damaging Het
Tiparp T A 3: 65,460,603 (GRCm39) F531I probably damaging Het
Tmem132b A T 5: 125,855,884 (GRCm39) I539F probably damaging Het
Ttf2 T C 3: 100,859,956 (GRCm39) D666G probably damaging Het
Vmn1r51 T C 6: 90,106,842 (GRCm39) S253P probably damaging Het
Vmn2r104 A G 17: 20,261,924 (GRCm39) I402T probably damaging Het
Vmn2r16 T C 5: 109,511,619 (GRCm39) Y609H probably benign Het
Vmn2r17 A T 5: 109,575,863 (GRCm39) M245L probably benign Het
Vmn2r42 C T 7: 8,197,792 (GRCm39) E276K probably benign Het
Wdr75 C A 1: 45,838,287 (GRCm39) N65K probably damaging Het
Zbtb47 A C 9: 121,596,705 (GRCm39) K687T probably damaging Het
Zfhx4 T C 3: 5,463,924 (GRCm39) S1361P probably damaging Het
Zfp317 T A 9: 19,558,708 (GRCm39) C396* probably null Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGACATTACTCCAAGCCTG -3'
(R):5'- GGTGATGTCATGAGTCCTTCCC -3'

Sequencing Primer
(F):5'- CCAAGCCTGGAACTCCTG -3'
(R):5'- TCCCCTGTCTAGCACACCAG -3'
Posted On 2021-08-31