Incidental Mutation 'R8900:Dock9'
ID 679929
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8900 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121580528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1627 (D1627G)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: D1636G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: D1636G

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: D1607G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: D1607G

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: D1637G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: D1627G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Meta Mutation Damage Score 0.2758 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,302,468 probably benign Het
Abca9 T C 11: 110,154,392 T372A probably benign Het
Adamts8 C A 9: 30,954,634 R493S probably benign Het
Ankrd33b G A 15: 31,297,684 T309I probably damaging Het
Arhgap22 G A 14: 33,271,923 W58* probably null Het
B4galt4 C T 16: 38,752,042 probably benign Het
Bcl2a1a A T 9: 88,957,258 I70L probably benign Het
Bst1 A G 5: 43,820,600 D97G possibly damaging Het
Cand2 C T 6: 115,780,933 T52M probably benign Het
Cd101 C A 3: 101,018,746 R219L probably benign Het
Cd163l1 G A 7: 140,228,565 W796* probably null Het
Cd5l T A 3: 87,367,575 D140E probably benign Het
Cebpa A G 7: 35,120,481 M355V possibly damaging Het
Cfap74 G A 4: 155,436,730 E620K Het
Clec4a4 A G 6: 123,023,916 E196G probably damaging Het
Cpxm1 T A 2: 130,393,440 D544V probably damaging Het
Cwf19l2 T A 9: 3,447,245 D535E probably benign Het
Daw1 T G 1: 83,198,177 L212R probably benign Het
Dnm3 T A 1: 162,307,876 T443S probably benign Het
Dohh A G 10: 81,387,901 I263V probably benign Het
Dsp G A 13: 38,181,179 V513M probably damaging Het
Dus4l G T 12: 31,640,693 L320I possibly damaging Het
Edc4 A C 8: 105,891,225 Q1139P probably damaging Het
Fam220a T A 5: 143,563,473 C213* probably null Het
Fgf14 A T 14: 123,983,914 Y159* probably null Het
Gm45861 A T 8: 27,529,604 D749V unknown Het
Hip1 T C 5: 135,430,290 T203A probably benign Het
Igfals A G 17: 24,880,040 D35G possibly damaging Het
Itga4 T A 2: 79,314,988 I716K probably damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Ndufb3 T C 1: 58,595,665 Y59H probably damaging Het
Nxpe3 T C 16: 55,844,660 H399R probably damaging Het
Nxph1 T C 6: 9,247,601 S191P probably damaging Het
Olfr29-ps1 G T 4: 43,781,432 S299R probably benign Het
Olfr59 T C 11: 74,289,587 S314P probably damaging Het
Pcdha11 T G 18: 37,012,746 I630S probably damaging Het
Pfkl C G 10: 78,000,781 G134A probably damaging Het
Phf19 A T 2: 34,905,472 C196S probably damaging Het
Piezo2 T C 18: 63,115,025 K468R probably benign Het
Plekhn1 T C 4: 156,225,621 S79G possibly damaging Het
Pomk A G 8: 25,983,356 Y190H possibly damaging Het
Ppp1r13b T A 12: 111,872,344 E33D probably damaging Het
Raly A T 2: 154,863,573 I174F probably damaging Het
Rint1 T C 5: 23,811,884 V549A possibly damaging Het
Rnf31 T G 14: 55,596,232 C566G probably damaging Het
Sdc1 C T 12: 8,790,460 T79I possibly damaging Het
Sema6a T G 18: 47,291,115 E242A probably damaging Het
Slc22a30 A C 19: 8,337,976 M430R probably damaging Het
Sp9 C A 2: 73,273,519 T139K probably benign Het
Tbkbp1 T C 11: 97,149,501 D29G probably benign Het
Tcf4 T C 18: 69,564,690 probably benign Het
Tenm3 A T 8: 48,236,402 I2050N probably damaging Het
Tiparp T A 3: 65,553,182 F531I probably damaging Het
Tmem132b A T 5: 125,778,820 I539F probably damaging Het
Ttf2 T C 3: 100,952,640 D666G probably damaging Het
Vmn1r51 T C 6: 90,129,860 S253P probably damaging Het
Vmn2r104 A G 17: 20,041,662 I402T probably damaging Het
Vmn2r16 T C 5: 109,363,753 Y609H probably benign Het
Vmn2r17 A T 5: 109,427,997 M245L probably benign Het
Vmn2r42 C T 7: 8,194,793 E276K probably benign Het
Wdr75 C A 1: 45,799,127 N65K probably damaging Het
Zfhx4 T C 3: 5,398,864 S1361P probably damaging Het
Zfp317 T A 9: 19,647,412 C396* probably null Het
Zfp651 A C 9: 121,767,639 K687T probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGACATTACTCCAAGCCTG -3'
(R):5'- GGTGATGTCATGAGTCCTTCCC -3'

Sequencing Primer
(F):5'- CCAAGCCTGGAACTCCTG -3'
(R):5'- TCCCCTGTCTAGCACACCAG -3'
Posted On 2021-08-31