Incidental Mutation 'R8900:Piezo2'
ID 679939
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik
MMRRC Submission 068757-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8900 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 63143284-63520254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63248096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 468 (K468R)
Ref Sequence ENSEMBL: ENSMUSP00000036099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046860
AA Change: K468R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: K468R

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047480
AA Change: K468R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: K468R

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000182233
AA Change: K236R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: K236R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183217
AA Change: K468R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: K468R

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,045,218 (GRCm39) T372A probably benign Het
Adamts8 C A 9: 30,865,930 (GRCm39) R493S probably benign Het
Ankrd33b G A 15: 31,297,830 (GRCm39) T309I probably damaging Het
Arhgap22 G A 14: 32,993,880 (GRCm39) W58* probably null Het
B4galt4 C T 16: 38,572,404 (GRCm39) probably benign Het
Bcl2a1a A T 9: 88,839,311 (GRCm39) I70L probably benign Het
Bst1 A G 5: 43,977,942 (GRCm39) D97G possibly damaging Het
Cand2 C T 6: 115,757,894 (GRCm39) T52M probably benign Het
Cd101 C A 3: 100,926,062 (GRCm39) R219L probably benign Het
Cd5l T A 3: 87,274,882 (GRCm39) D140E probably benign Het
Cdcp3 A T 7: 130,904,197 (GRCm39) probably benign Het
Cebpa A G 7: 34,819,906 (GRCm39) M355V possibly damaging Het
Cfap74 G A 4: 155,521,187 (GRCm39) E620K Het
Clec4a4 A G 6: 123,000,875 (GRCm39) E196G probably damaging Het
Cpxm1 T A 2: 130,235,360 (GRCm39) D544V probably damaging Het
Cwf19l2 T A 9: 3,447,245 (GRCm39) D535E probably benign Het
Daw1 T G 1: 83,175,898 (GRCm39) L212R probably benign Het
Dnm3 T A 1: 162,135,445 (GRCm39) T443S probably benign Het
Dock9 T C 14: 121,817,940 (GRCm39) D1627G probably damaging Het
Dohh A G 10: 81,223,735 (GRCm39) I263V probably benign Het
Dsp G A 13: 38,365,155 (GRCm39) V513M probably damaging Het
Dus4l G T 12: 31,690,692 (GRCm39) L320I possibly damaging Het
Edc4 A C 8: 106,617,857 (GRCm39) Q1139P probably damaging Het
Fam220a T A 5: 143,549,228 (GRCm39) C213* probably null Het
Fgf14 A T 14: 124,221,326 (GRCm39) Y159* probably null Het
Gm45861 A T 8: 28,019,632 (GRCm39) D749V unknown Het
Hip1 T C 5: 135,459,144 (GRCm39) T203A probably benign Het
Igfals A G 17: 25,099,014 (GRCm39) D35G possibly damaging Het
Itga4 T A 2: 79,145,332 (GRCm39) I716K probably damaging Het
Ncaph2 T A 15: 89,253,594 (GRCm39) I282N probably benign Het
Ndufb3 T C 1: 58,634,824 (GRCm39) Y59H probably damaging Het
Nxpe3 T C 16: 55,665,023 (GRCm39) H399R probably damaging Het
Nxph1 T C 6: 9,247,601 (GRCm39) S191P probably damaging Het
Or13c7e-ps1 G T 4: 43,781,432 (GRCm39) S299R probably benign Het
Or1p1 T C 11: 74,180,413 (GRCm39) S314P probably damaging Het
Pcdha11 T G 18: 37,145,799 (GRCm39) I630S probably damaging Het
Pfkl C G 10: 77,836,615 (GRCm39) G134A probably damaging Het
Phf19 A T 2: 34,795,484 (GRCm39) C196S probably damaging Het
Plekhn1 T C 4: 156,310,078 (GRCm39) S79G possibly damaging Het
Pomk A G 8: 26,473,384 (GRCm39) Y190H possibly damaging Het
Ppp1r13b T A 12: 111,838,778 (GRCm39) E33D probably damaging Het
Raly A T 2: 154,705,493 (GRCm39) I174F probably damaging Het
Rint1 T C 5: 24,016,882 (GRCm39) V549A possibly damaging Het
Rnf31 T G 14: 55,833,689 (GRCm39) C566G probably damaging Het
Scart1 G A 7: 139,808,478 (GRCm39) W796* probably null Het
Sdc1 C T 12: 8,840,460 (GRCm39) T79I possibly damaging Het
Sema6a T G 18: 47,424,182 (GRCm39) E242A probably damaging Het
Slc22a30 A C 19: 8,315,340 (GRCm39) M430R probably damaging Het
Sp9 C A 2: 73,103,863 (GRCm39) T139K probably benign Het
Tbkbp1 T C 11: 97,040,327 (GRCm39) D29G probably benign Het
Tcf4 T C 18: 69,697,761 (GRCm39) probably benign Het
Tenm3 A T 8: 48,689,437 (GRCm39) I2050N probably damaging Het
Tiparp T A 3: 65,460,603 (GRCm39) F531I probably damaging Het
Tmem132b A T 5: 125,855,884 (GRCm39) I539F probably damaging Het
Ttf2 T C 3: 100,859,956 (GRCm39) D666G probably damaging Het
Vmn1r51 T C 6: 90,106,842 (GRCm39) S253P probably damaging Het
Vmn2r104 A G 17: 20,261,924 (GRCm39) I402T probably damaging Het
Vmn2r16 T C 5: 109,511,619 (GRCm39) Y609H probably benign Het
Vmn2r17 A T 5: 109,575,863 (GRCm39) M245L probably benign Het
Vmn2r42 C T 7: 8,197,792 (GRCm39) E276K probably benign Het
Wdr75 C A 1: 45,838,287 (GRCm39) N65K probably damaging Het
Zbtb47 A C 9: 121,596,705 (GRCm39) K687T probably damaging Het
Zfhx4 T C 3: 5,463,924 (GRCm39) S1361P probably damaging Het
Zfp317 T A 9: 19,558,708 (GRCm39) C396* probably null Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,250,770 (GRCm39) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,155,531 (GRCm39) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,203,101 (GRCm39) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,257,685 (GRCm39) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,163,463 (GRCm39) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,315,904 (GRCm39) splice site probably benign
IGL01674:Piezo2 APN 18 63,160,630 (GRCm39) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,216,241 (GRCm39) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,175,859 (GRCm39) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,225,915 (GRCm39) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,153,705 (GRCm39) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,279,915 (GRCm39) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,205,933 (GRCm39) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,165,995 (GRCm39) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,157,546 (GRCm39) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,207,730 (GRCm39) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,197,856 (GRCm39) splice site probably benign
IGL03011:Piezo2 APN 18 63,257,731 (GRCm39) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,203,146 (GRCm39) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,163,343 (GRCm39) splice site probably null
IGL03129:Piezo2 APN 18 63,248,043 (GRCm39) missense probably benign
IGL03143:Piezo2 APN 18 63,241,147 (GRCm39) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,144,669 (GRCm39) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,257,677 (GRCm39) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,186,133 (GRCm39) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,174,791 (GRCm39) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,144,609 (GRCm39) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,154,379 (GRCm39) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,160,775 (GRCm39) missense probably damaging 1.00
Piccolo UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
sopranino UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
woodwind UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,519,271 (GRCm39) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,157,540 (GRCm39) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,235,155 (GRCm39) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,157,562 (GRCm39) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,162,132 (GRCm39) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,235,245 (GRCm39) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,157,522 (GRCm39) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,160,615 (GRCm39) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,155,552 (GRCm39) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,155,497 (GRCm39) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,152,329 (GRCm39) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,174,794 (GRCm39) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,216,306 (GRCm39) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,148,873 (GRCm39) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,219,824 (GRCm39) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,154,325 (GRCm39) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,216,202 (GRCm39) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,277,990 (GRCm39) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,215,986 (GRCm39) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,250,743 (GRCm39) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,154,244 (GRCm39) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,239,355 (GRCm39) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,241,158 (GRCm39) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,165,911 (GRCm39) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,152,415 (GRCm39) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,247,031 (GRCm39) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,211,911 (GRCm39) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,211,852 (GRCm39) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,277,997 (GRCm39) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,192,815 (GRCm39) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,252,006 (GRCm39) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,214,805 (GRCm39) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,250,791 (GRCm39) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,247,112 (GRCm39) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,239,345 (GRCm39) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,155,596 (GRCm39) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,378,695 (GRCm39) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,186,106 (GRCm39) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,279,914 (GRCm39) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,157,506 (GRCm39) nonsense probably null
R3016:Piezo2 UTSW 18 63,175,903 (GRCm39) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,214,864 (GRCm39) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,183,675 (GRCm39) missense probably benign
R4181:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,217,911 (GRCm39) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,235,170 (GRCm39) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,247,134 (GRCm39) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,205,951 (GRCm39) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,219,699 (GRCm39) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,203,034 (GRCm39) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,278,025 (GRCm39) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,211,862 (GRCm39) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,290,333 (GRCm39) missense probably benign
R4961:Piezo2 UTSW 18 63,186,032 (GRCm39) splice site probably null
R4968:Piezo2 UTSW 18 63,278,042 (GRCm39) nonsense probably null
R4973:Piezo2 UTSW 18 63,207,751 (GRCm39) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,216,184 (GRCm39) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,157,607 (GRCm39) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,207,691 (GRCm39) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,163,480 (GRCm39) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,166,000 (GRCm39) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,197,802 (GRCm39) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,217,811 (GRCm39) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,278,176 (GRCm39) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,160,935 (GRCm39) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,144,792 (GRCm39) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,278,162 (GRCm39) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,250,768 (GRCm39) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,250,767 (GRCm39) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,279,927 (GRCm39) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,160,972 (GRCm39) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,247,005 (GRCm39) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6073:Piezo2 UTSW 18 63,145,716 (GRCm39) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,290,281 (GRCm39) nonsense probably null
R6255:Piezo2 UTSW 18 63,254,341 (GRCm39) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,250,749 (GRCm39) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,239,364 (GRCm39) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,219,678 (GRCm39) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,174,734 (GRCm39) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,239,342 (GRCm39) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,154,399 (GRCm39) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,154,333 (GRCm39) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,165,960 (GRCm39) nonsense probably null
R6855:Piezo2 UTSW 18 63,223,950 (GRCm39) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,166,057 (GRCm39) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,216,032 (GRCm39) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,278,181 (GRCm39) nonsense probably null
R7162:Piezo2 UTSW 18 63,257,780 (GRCm39) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,241,101 (GRCm39) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,150,590 (GRCm39) splice site probably null
R7395:Piezo2 UTSW 18 63,160,634 (GRCm39) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,157,543 (GRCm39) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,145,794 (GRCm39) missense probably benign
R7517:Piezo2 UTSW 18 63,215,996 (GRCm39) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,186,081 (GRCm39) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,175,610 (GRCm39) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,246,947 (GRCm39) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,216,016 (GRCm39) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,216,271 (GRCm39) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,175,882 (GRCm39) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,163,537 (GRCm39) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,208,801 (GRCm39) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,145,857 (GRCm39) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,217,759 (GRCm39) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,178,611 (GRCm39) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,279,873 (GRCm39) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,225,971 (GRCm39) nonsense probably null
R8708:Piezo2 UTSW 18 63,226,086 (GRCm39) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8727:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8810:Piezo2 UTSW 18 63,248,034 (GRCm39) missense probably benign 0.41
R9037:Piezo2 UTSW 18 63,225,902 (GRCm39) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,178,550 (GRCm39) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,250,815 (GRCm39) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,290,302 (GRCm39) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,154,372 (GRCm39) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,208,868 (GRCm39) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,157,637 (GRCm39) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,162,156 (GRCm39) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,235,236 (GRCm39) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,519,347 (GRCm39) start gained probably benign
R9608:Piezo2 UTSW 18 63,280,016 (GRCm39) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,248,108 (GRCm39) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,197,767 (GRCm39) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,160,657 (GRCm39) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,183,681 (GRCm39) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,150,648 (GRCm39) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,203,065 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTAACTGAGTCTCAACCCTG -3'
(R):5'- TGGACCATTATTCCCACCAGTC -3'

Sequencing Primer
(F):5'- AGTCTCAACCCTGGCTGAGAG -3'
(R):5'- ACCAGTCAGAACTTAGGGCTTCTG -3'
Posted On 2021-08-31