Incidental Mutation 'R8901:Tas2r114'
ID 679963
Institutional Source Beutler Lab
Gene Symbol Tas2r114
Ensembl Gene ENSMUSG00000063478
Gene Name taste receptor, type 2, member 114
Synonyms mt2r46, mGR14, T2R14, Tas2r14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8901 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 131689134-131690063 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 131689951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 38 (N38I)
Ref Sequence ENSEMBL: ENSMUSP00000079453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
AlphaFold Q7M722
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080619
AA Change: N38I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: N38I

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Meta Mutation Damage Score 0.4088 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprm T C 11: 67,041,738 N115S probably damaging Het
Agbl5 T C 5: 30,891,091 V169A possibly damaging Het
Ajuba T C 14: 54,570,373 probably benign Het
Ankrd27 G A 7: 35,632,818 probably benign Het
Brat1 T A 5: 140,712,853 M260K probably benign Het
Btbd6 G T 12: 112,976,600 probably benign Het
Cenpf C T 1: 189,662,051 G503S probably benign Het
Ces1e C T 8: 93,210,475 D323N probably damaging Het
Chrna5 T C 9: 55,004,453 F75S probably damaging Het
Clmn A T 12: 104,780,952 S779T probably benign Het
Cntnap5c T A 17: 58,330,161 M1011K probably benign Het
Col11a2 A T 17: 34,043,280 I164F probably damaging Het
Daw1 A C 1: 83,205,922 K231T possibly damaging Het
Dnah5 T G 15: 28,365,569 M2637R possibly damaging Het
Dsp G A 13: 38,181,179 V513M probably damaging Het
Eea1 T G 10: 95,989,569 I42R probably damaging Het
Ehd4 A T 2: 120,102,324 I207N probably damaging Het
F11 T C 8: 45,248,814 T320A probably benign Het
Fhdc1 T A 3: 84,445,567 M784L probably benign Het
Gm13083 A T 4: 143,617,107 I326F probably benign Het
Gm21411 G A 4: 146,897,714 Q10* probably null Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gnao1 T C 8: 93,968,059 M70T probably benign Het
Gtf2i A G 5: 134,295,535 F25S probably damaging Het
H2-T3 A T 17: 36,187,360 D220E probably damaging Het
Hnrnpul2 T G 19: 8,824,445 L339R probably damaging Het
Impg2 A T 16: 56,252,165 D320V probably damaging Het
Itga2b A T 11: 102,460,804 L565Q probably damaging Het
Jph3 A T 8: 121,730,822 Q67L probably damaging Het
Khnyn T C 14: 55,886,586 F99S probably damaging Het
Lhcgr A T 17: 88,755,602 L214Q probably damaging Het
Lix1l C A 3: 96,601,429 probably benign Het
Mettl13 C T 1: 162,546,245 V95I possibly damaging Het
Nod2 C T 8: 88,663,809 T226M probably damaging Het
Nwd2 T C 5: 63,806,342 W1090R probably damaging Het
Olfr1386 A T 11: 49,470,208 D19V probably damaging Het
Pla2r1 C A 2: 60,502,056 V481F Het
Polr1b T A 2: 129,125,675 V996E probably damaging Het
Ppfia3 T A 7: 45,341,717 R1027W probably damaging Het
Rap1gds1 T C 3: 138,957,544 D298G probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Scn3a C T 2: 65,521,908 V353M probably benign Het
Setd1b T C 5: 123,161,051 probably benign Het
Slc25a42 A G 8: 70,194,149 V19A probably benign Het
Smarcal1 T C 1: 72,585,780 S29P possibly damaging Het
Sntb2 T C 8: 107,011,343 F508L possibly damaging Het
Syt15 G T 14: 34,226,071 R291L probably damaging Het
Tg T A 15: 66,685,335 N948K probably damaging Het
Tmem115 A G 9: 107,534,794 probably benign Het
Ttll8 C T 15: 88,933,943 D175N probably benign Het
Txk T A 5: 72,700,707 Y398F probably damaging Het
Wdr36 C A 18: 32,846,960 T246K probably damaging Het
Wdr43 A T 17: 71,625,466 R113S probably benign Het
Ybx1 T C 4: 119,281,588 Y239C probably damaging Het
Other mutations in Tas2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Tas2r114 APN 6 131689701 nonsense probably null
IGL02971:Tas2r114 APN 6 131689280 missense probably benign 0.00
R0561:Tas2r114 UTSW 6 131689795 missense probably benign 0.30
R3034:Tas2r114 UTSW 6 131689648 missense probably benign 0.15
R3687:Tas2r114 UTSW 6 131689268 missense probably benign 0.25
R4411:Tas2r114 UTSW 6 131689622 missense probably benign 0.06
R4826:Tas2r114 UTSW 6 131689837 missense probably damaging 0.99
R4889:Tas2r114 UTSW 6 131689795 missense probably damaging 0.96
R5084:Tas2r114 UTSW 6 131689288 nonsense probably null
R5258:Tas2r114 UTSW 6 131689541 missense probably benign 0.03
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6499:Tas2r114 UTSW 6 131689136 makesense probably null
R7164:Tas2r114 UTSW 6 131689765 missense possibly damaging 0.74
R7276:Tas2r114 UTSW 6 131689347 missense probably damaging 0.96
R7745:Tas2r114 UTSW 6 131689438 missense probably damaging 1.00
R7851:Tas2r114 UTSW 6 131689925 missense probably damaging 1.00
R8002:Tas2r114 UTSW 6 131689139 missense probably damaging 1.00
R9297:Tas2r114 UTSW 6 131689324 missense probably damaging 0.96
R9380:Tas2r114 UTSW 6 131689418 missense probably benign 0.00
R9402:Tas2r114 UTSW 6 131689931 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGGCAAACCAGACATTCAATTG -3'
(R):5'- TGAAGGGATCTCCATGAAGACC -3'

Sequencing Primer
(F):5'- TGACAGGAGACAGCAACT -3'
(R):5'- AGCCACTCTTTTATTGAACAGC -3'
Posted On 2021-08-31