Incidental Mutation 'R8901:Wdr43'
ID 679989
Institutional Source Beutler Lab
Gene Symbol Wdr43
Ensembl Gene ENSMUSG00000041057
Gene Name WD repeat domain 43
Synonyms 2610318G08Rik
Accession Numbers

Ncbi RefSeq: NM_175639.1; MGI:1919765

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R8901 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 71616215-71659031 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71625466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 113 (R113S)
Ref Sequence ENSEMBL: ENSMUSP00000048337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047086]
AlphaFold Q6ZQL4
Predicted Effect probably benign
Transcript: ENSMUST00000047086
AA Change: R113S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000048337
Gene: ENSMUSG00000041057
AA Change: R113S

DomainStartEndE-ValueType
WD40 8 42 4.42e1 SMART
WD40 45 110 2.2e2 SMART
WD40 113 154 7.85e-7 SMART
WD40 157 194 1.24e-4 SMART
WD40 197 249 5.52e0 SMART
Blast:WD40 256 299 1e-18 BLAST
low complexity region 320 334 N/A INTRINSIC
Pfam:Utp12 472 575 2.3e-23 PFAM
coiled coil region 635 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (53/53)
Allele List at MGI

All alleles(36) : Gene trapped(36)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprm T C 11: 67,041,738 N115S probably damaging Het
Agbl5 T C 5: 30,891,091 V169A possibly damaging Het
Ajuba T C 14: 54,570,373 probably benign Het
Ankrd27 G A 7: 35,632,818 probably benign Het
Brat1 T A 5: 140,712,853 M260K probably benign Het
Btbd6 G T 12: 112,976,600 probably benign Het
Cenpf C T 1: 189,662,051 G503S probably benign Het
Ces1e C T 8: 93,210,475 D323N probably damaging Het
Chrna5 T C 9: 55,004,453 F75S probably damaging Het
Clmn A T 12: 104,780,952 S779T probably benign Het
Cntnap5c T A 17: 58,330,161 M1011K probably benign Het
Col11a2 A T 17: 34,043,280 I164F probably damaging Het
Daw1 A C 1: 83,205,922 K231T possibly damaging Het
Dnah5 T G 15: 28,365,569 M2637R possibly damaging Het
Dsp G A 13: 38,181,179 V513M probably damaging Het
Eea1 T G 10: 95,989,569 I42R probably damaging Het
Ehd4 A T 2: 120,102,324 I207N probably damaging Het
F11 T C 8: 45,248,814 T320A probably benign Het
Fhdc1 T A 3: 84,445,567 M784L probably benign Het
Gm13083 A T 4: 143,617,107 I326F probably benign Het
Gm21411 G A 4: 146,897,714 Q10* probably null Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gnao1 T C 8: 93,968,059 M70T probably benign Het
Gtf2i A G 5: 134,295,535 F25S probably damaging Het
H2-T3 A T 17: 36,187,360 D220E probably damaging Het
Hnrnpul2 T G 19: 8,824,445 L339R probably damaging Het
Impg2 A T 16: 56,252,165 D320V probably damaging Het
Itga2b A T 11: 102,460,804 L565Q probably damaging Het
Jph3 A T 8: 121,730,822 Q67L probably damaging Het
Khnyn T C 14: 55,886,586 F99S probably damaging Het
Lhcgr A T 17: 88,755,602 L214Q probably damaging Het
Lix1l C A 3: 96,601,429 probably benign Het
Mettl13 C T 1: 162,546,245 V95I possibly damaging Het
Nod2 C T 8: 88,663,809 T226M probably damaging Het
Nwd2 T C 5: 63,806,342 W1090R probably damaging Het
Olfr1386 A T 11: 49,470,208 D19V probably damaging Het
Pla2r1 C A 2: 60,502,056 V481F Het
Polr1b T A 2: 129,125,675 V996E probably damaging Het
Ppfia3 T A 7: 45,341,717 R1027W probably damaging Het
Rap1gds1 T C 3: 138,957,544 D298G probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Scn3a C T 2: 65,521,908 V353M probably benign Het
Setd1b T C 5: 123,161,051 probably benign Het
Slc25a42 A G 8: 70,194,149 V19A probably benign Het
Smarcal1 T C 1: 72,585,780 S29P possibly damaging Het
Sntb2 T C 8: 107,011,343 F508L possibly damaging Het
Syt15 G T 14: 34,226,071 R291L probably damaging Het
Tas2r114 T A 6: 131,689,951 N38I probably damaging Het
Tg T A 15: 66,685,335 N948K probably damaging Het
Tmem115 A G 9: 107,534,794 probably benign Het
Ttll8 C T 15: 88,933,943 D175N probably benign Het
Txk T A 5: 72,700,707 Y398F probably damaging Het
Wdr36 C A 18: 32,846,960 T246K probably damaging Het
Ybx1 T C 4: 119,281,588 Y239C probably damaging Het
Other mutations in Wdr43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr43 APN 17 71652814 missense probably damaging 1.00
IGL02077:Wdr43 APN 17 71640291 missense probably benign 0.00
IGL02114:Wdr43 APN 17 71652848 missense probably benign 0.00
IGL02252:Wdr43 APN 17 71626850 missense probably damaging 1.00
IGL02352:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL02359:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL03082:Wdr43 APN 17 71638341 missense probably damaging 0.99
IGL03095:Wdr43 APN 17 71641287 missense probably benign 0.28
IGL02837:Wdr43 UTSW 17 71642736 missense probably benign 0.00
R0039:Wdr43 UTSW 17 71653492 nonsense probably null
R0164:Wdr43 UTSW 17 71631997 splice site probably benign
R0271:Wdr43 UTSW 17 71626825 missense probably benign 0.00
R1117:Wdr43 UTSW 17 71616387 missense probably benign 0.35
R1873:Wdr43 UTSW 17 71633652 missense probably benign 0.05
R1973:Wdr43 UTSW 17 71640240 missense probably benign 0.00
R3620:Wdr43 UTSW 17 71650606 missense probably benign 0.13
R3922:Wdr43 UTSW 17 71638301 splice site probably benign
R4097:Wdr43 UTSW 17 71657537 missense probably benign
R5067:Wdr43 UTSW 17 71626854 missense probably benign
R5282:Wdr43 UTSW 17 71648777 missense probably damaging 1.00
R6251:Wdr43 UTSW 17 71650053 splice site probably null
R6364:Wdr43 UTSW 17 71657654 missense probably damaging 0.96
R7086:Wdr43 UTSW 17 71616439 missense probably benign 0.02
R7725:Wdr43 UTSW 17 71616343 missense probably benign 0.27
R8104:Wdr43 UTSW 17 71616355 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCACTAGCGTTTATGCATTG -3'
(R):5'- AGCCAAAGTTCTCTGTACTCTAAC -3'

Sequencing Primer
(F):5'- GCACTAGCGTTTATGCATTGTTAATG -3'
(R):5'- CTCTGTACTCTAACTCACAAGTAGG -3'
Posted On 2021-08-31