Incidental Mutation 'R8905:Dnah7b'
ID 679994
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms LOC227058, Dnahc7b
MMRRC Submission 068762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R8905 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46105475-46412710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 46292534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 2973 (Q2973P)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069293
AA Change: Q2973P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: Q2973P

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,182,553 (GRCm39) V236A probably benign Het
Abca15 A T 7: 119,960,771 (GRCm39) R744S probably benign Het
Adgra1 T C 7: 139,455,763 (GRCm39) S464P probably damaging Het
Arhgap45 T C 10: 79,855,570 (GRCm39) V3A probably benign Het
AW554918 T A 18: 25,473,206 (GRCm39) S134T probably damaging Het
Bmper A G 9: 23,318,082 (GRCm39) E567G probably benign Het
C2cd3 T C 7: 100,074,132 (GRCm39) probably null Het
Cars1 A G 7: 143,140,196 (GRCm39) Y170H probably damaging Het
Celsr1 A T 15: 85,788,269 (GRCm39) probably benign Het
Celsr3 C T 9: 108,718,501 (GRCm39) H2351Y probably damaging Het
Cfap210 A G 2: 69,612,104 (GRCm39) S175P probably benign Het
Clxn A G 16: 14,738,275 (GRCm39) I147V possibly damaging Het
Cyp2d11 T C 15: 82,275,102 (GRCm39) I282V probably benign Het
Dhfr A G 13: 92,494,467 (GRCm39) T57A probably damaging Het
Dhrs7l T A 12: 72,666,431 (GRCm39) D80V probably damaging Het
Dnajc5b T C 3: 19,633,184 (GRCm39) C136R probably benign Het
Ercc3 T G 18: 32,398,771 (GRCm39) D683E possibly damaging Het
Faxc A G 4: 21,982,398 (GRCm39) Y279C probably damaging Het
Fbxw7 T C 3: 84,872,634 (GRCm39) M191T possibly damaging Het
Fcgbp T A 7: 27,785,934 (GRCm39) V457E probably damaging Het
Fip1l1 A T 5: 74,756,624 (GRCm39) T539S probably damaging Het
Gabra1 T C 11: 42,038,052 (GRCm39) T189A possibly damaging Het
Glg1 T C 8: 111,884,668 (GRCm39) D1118G probably damaging Het
Gli3 A G 13: 15,901,116 (GRCm39) D1501G probably benign Het
Hacd1 A G 2: 14,049,761 (GRCm39) I91T possibly damaging Het
Ift22 T C 5: 136,941,745 (GRCm39) V159A probably benign Het
Igkv1-110 T A 6: 68,248,070 (GRCm39) Y60N probably damaging Het
Inpp5d A G 1: 87,637,348 (GRCm39) K502E probably damaging Het
Kcnt2 A T 1: 140,435,467 (GRCm39) Q478L possibly damaging Het
Mettl13 A G 1: 162,364,847 (GRCm39) F511L probably damaging Het
Mis18bp1 T C 12: 65,180,401 (GRCm39) probably null Het
Mrps30 A T 13: 118,523,479 (GRCm39) S98T probably benign Het
Muc2 C T 7: 141,279,643 (GRCm39) A209V probably benign Het
Nfs1 A T 2: 155,970,503 (GRCm39) I270N probably damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nsmaf A G 4: 6,424,951 (GRCm39) S266P probably benign Het
Obscn A G 11: 58,960,784 (GRCm39) S3176P probably damaging Het
Or4c123 A T 2: 89,126,801 (GRCm39) L271Q possibly damaging Het
Or7g12 A G 9: 18,899,494 (GRCm39) D70G possibly damaging Het
P2ry12 T A 3: 59,124,997 (GRCm39) Y226F probably damaging Het
Pabpc2 C A 18: 39,907,704 (GRCm39) T323K probably benign Het
Pank2 A G 2: 131,124,646 (GRCm39) D71G possibly damaging Het
Patj A T 4: 98,385,412 (GRCm39) H393L probably damaging Het
Pde8b A G 13: 95,182,993 (GRCm39) V255A probably damaging Het
Plekhs1 T C 19: 56,471,028 (GRCm39) W374R probably damaging Het
Ppm1g T C 5: 31,361,437 (GRCm39) D313G probably damaging Het
Rnf114 A G 2: 167,353,134 (GRCm39) N135S probably benign Het
Rnf43 T G 11: 87,621,951 (GRCm39) Y351D probably damaging Het
Robo1 A T 16: 72,539,173 (GRCm39) D90V probably damaging Het
Sbds A G 5: 130,277,125 (GRCm39) V172A possibly damaging Het
Scamp5 T A 9: 57,352,669 (GRCm39) I167F probably benign Het
Sec14l5 A G 16: 4,994,364 (GRCm39) E386G probably damaging Het
Sfxn1 T A 13: 54,246,433 (GRCm39) V159E probably damaging Het
Sgsm1 C T 5: 113,421,495 (GRCm39) G531R probably benign Het
Slc22a26 T A 19: 7,760,331 (GRCm39) I471F probably damaging Het
Slc41a3 T A 6: 90,589,123 (GRCm39) M78K probably benign Het
Slc8a1 A T 17: 81,749,084 (GRCm39) Y653N probably benign Het
Slco6c1 A T 1: 97,053,391 (GRCm39) M170K possibly damaging Het
Smarca5 A T 8: 81,440,577 (GRCm39) I629K probably benign Het
Smg7 T A 1: 152,715,817 (GRCm39) D1099V probably damaging Het
Spata31e2 A G 1: 26,721,895 (GRCm39) V1095A probably damaging Het
Srbd1 T C 17: 86,308,890 (GRCm39) I763V probably benign Het
Stk25 A G 1: 93,556,929 (GRCm39) S30P probably damaging Het
Sv2b C T 7: 74,767,459 (GRCm39) A646T probably benign Het
Tardbp T C 4: 148,705,093 (GRCm39) M167V probably benign Het
Tmem132a T C 19: 10,842,647 (GRCm39) N276S probably damaging Het
Ttpa T A 4: 20,028,435 (GRCm39) S162T probably benign Het
Usp13 T C 3: 32,935,572 (GRCm39) Y333H probably damaging Het
Vmn2r3 T A 3: 64,166,695 (GRCm39) Y812F probably damaging Het
Yeats2 A G 16: 20,009,144 (GRCm39) T463A probably benign Het
Zbtb26 T A 2: 37,326,927 (GRCm39) K36N probably benign Het
Zfc3h1 A T 10: 115,259,383 (GRCm39) T1652S probably benign Het
Zfp472 G A 17: 33,197,455 (GRCm39) C510Y possibly damaging Het
Zfp518a C A 19: 40,902,780 (GRCm39) T903K probably damaging Het
Zfp668 T C 7: 127,465,598 (GRCm39) T529A probably benign Het
Zfp930 A G 8: 69,681,351 (GRCm39) T349A possibly damaging Het
Zmiz2 T G 11: 6,346,840 (GRCm39) Y182D probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,181,309 (GRCm39) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,250,497 (GRCm39) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,263,811 (GRCm39) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,105,889 (GRCm39) unclassified probably benign
IGL00950:Dnah7b APN 1 46,253,482 (GRCm39) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,234,538 (GRCm39) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,120,592 (GRCm39) splice site probably benign
IGL01392:Dnah7b APN 1 46,165,948 (GRCm39) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,155,460 (GRCm39) splice site probably benign
IGL01460:Dnah7b APN 1 46,178,864 (GRCm39) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,307,813 (GRCm39) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,397,307 (GRCm39) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,397,297 (GRCm39) nonsense probably null
IGL01906:Dnah7b APN 1 46,214,613 (GRCm39) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,163,497 (GRCm39) splice site probably benign
IGL01989:Dnah7b APN 1 46,328,694 (GRCm39) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,179,035 (GRCm39) missense probably benign
IGL02213:Dnah7b APN 1 46,272,752 (GRCm39) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,266,090 (GRCm39) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,138,663 (GRCm39) nonsense probably null
IGL02381:Dnah7b APN 1 46,316,280 (GRCm39) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,273,353 (GRCm39) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,234,478 (GRCm39) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,162,937 (GRCm39) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,155,461 (GRCm39) splice site probably benign
IGL02704:Dnah7b APN 1 46,181,293 (GRCm39) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,138,768 (GRCm39) splice site probably benign
IGL02745:Dnah7b APN 1 46,234,189 (GRCm39) splice site probably benign
IGL02818:Dnah7b APN 1 46,329,968 (GRCm39) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,158,458 (GRCm39) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,221,535 (GRCm39) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,124,849 (GRCm39) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,158,464 (GRCm39) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,412,508 (GRCm39) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,252,520 (GRCm39) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,262,338 (GRCm39) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,258,508 (GRCm39) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,162,937 (GRCm39) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,246,803 (GRCm39) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,173,816 (GRCm39) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,280,104 (GRCm39) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,316,286 (GRCm39) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,275,948 (GRCm39) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,179,336 (GRCm39) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,258,704 (GRCm39) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,280,152 (GRCm39) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,379,292 (GRCm39) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,138,772 (GRCm39) splice site probably benign
R1035:Dnah7b UTSW 1 46,163,608 (GRCm39) missense probably benign
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,364,970 (GRCm39) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,379,280 (GRCm39) missense probably benign 0.00
R1318:Dnah7b UTSW 1 46,138,669 (GRCm39) missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,328,816 (GRCm39) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,117,753 (GRCm39) splice site probably benign
R1484:Dnah7b UTSW 1 46,176,703 (GRCm39) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,216,441 (GRCm39) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,105,957 (GRCm39) missense unknown
R1607:Dnah7b UTSW 1 46,329,806 (GRCm39) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,392,126 (GRCm39) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,214,550 (GRCm39) nonsense probably null
R1681:Dnah7b UTSW 1 46,363,872 (GRCm39) nonsense probably null
R1716:Dnah7b UTSW 1 46,230,943 (GRCm39) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,272,919 (GRCm39) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,316,265 (GRCm39) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,155,337 (GRCm39) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,275,874 (GRCm39) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,281,263 (GRCm39) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,181,247 (GRCm39) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,281,481 (GRCm39) nonsense probably null
R2083:Dnah7b UTSW 1 46,280,227 (GRCm39) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,137,152 (GRCm39) splice site probably benign
R2172:Dnah7b UTSW 1 46,163,672 (GRCm39) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,240,344 (GRCm39) splice site probably benign
R2247:Dnah7b UTSW 1 46,316,223 (GRCm39) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,273,075 (GRCm39) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,402,114 (GRCm39) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,234,447 (GRCm39) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,178,901 (GRCm39) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,246,732 (GRCm39) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,227,847 (GRCm39) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,221,583 (GRCm39) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,307,869 (GRCm39) missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46,392,033 (GRCm39) missense probably benign 0.00
R3735:Dnah7b UTSW 1 46,339,035 (GRCm39) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,282,417 (GRCm39) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,176,645 (GRCm39) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,272,871 (GRCm39) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,120,655 (GRCm39) missense probably benign
R4172:Dnah7b UTSW 1 46,266,106 (GRCm39) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,176,578 (GRCm39) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,260,932 (GRCm39) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
R4414:Dnah7b UTSW 1 46,165,840 (GRCm39) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,124,792 (GRCm39) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,328,696 (GRCm39) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,117,684 (GRCm39) missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46,256,317 (GRCm39) missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46,250,488 (GRCm39) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,246,816 (GRCm39) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,106,115 (GRCm39) missense unknown
R4780:Dnah7b UTSW 1 46,392,174 (GRCm39) missense probably benign
R4828:Dnah7b UTSW 1 46,167,272 (GRCm39) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,395,762 (GRCm39) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,234,234 (GRCm39) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,120,604 (GRCm39) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,240,478 (GRCm39) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,329,935 (GRCm39) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,272,886 (GRCm39) missense probably benign
R5000:Dnah7b UTSW 1 46,138,663 (GRCm39) nonsense probably null
R5005:Dnah7b UTSW 1 46,281,188 (GRCm39) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,226,523 (GRCm39) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,221,540 (GRCm39) nonsense probably null
R5174:Dnah7b UTSW 1 46,282,509 (GRCm39) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,397,376 (GRCm39) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,273,018 (GRCm39) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,412,514 (GRCm39) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,272,849 (GRCm39) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,256,351 (GRCm39) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,227,819 (GRCm39) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,397,431 (GRCm39) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,281,366 (GRCm39) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,281,179 (GRCm39) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,148,472 (GRCm39) missense probably null
R5479:Dnah7b UTSW 1 46,262,265 (GRCm39) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,281,359 (GRCm39) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,395,674 (GRCm39) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,307,924 (GRCm39) splice site probably null
R5659:Dnah7b UTSW 1 46,392,009 (GRCm39) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,273,152 (GRCm39) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,316,280 (GRCm39) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,181,292 (GRCm39) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,230,885 (GRCm39) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,376,753 (GRCm39) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,260,803 (GRCm39) missense probably benign
R5941:Dnah7b UTSW 1 46,226,450 (GRCm39) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,402,147 (GRCm39) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,158,558 (GRCm39) splice site probably null
R6041:Dnah7b UTSW 1 46,328,805 (GRCm39) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,178,949 (GRCm39) missense probably benign
R6049:Dnah7b UTSW 1 46,124,762 (GRCm39) missense probably benign
R6131:Dnah7b UTSW 1 46,292,626 (GRCm39) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,329,863 (GRCm39) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,272,745 (GRCm39) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,165,828 (GRCm39) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,265,048 (GRCm39) missense probably benign
R6273:Dnah7b UTSW 1 46,281,476 (GRCm39) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,379,335 (GRCm39) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,281,364 (GRCm39) nonsense probably null
R6494:Dnah7b UTSW 1 46,138,591 (GRCm39) missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46,263,902 (GRCm39) missense probably benign 0.12
R6800:Dnah7b UTSW 1 46,379,377 (GRCm39) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,230,948 (GRCm39) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,234,280 (GRCm39) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,158,428 (GRCm39) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,397,398 (GRCm39) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,234,299 (GRCm39) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,275,969 (GRCm39) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,391,973 (GRCm39) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,178,870 (GRCm39) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,281,302 (GRCm39) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,179,126 (GRCm39) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,122,914 (GRCm39) missense probably benign
R7244:Dnah7b UTSW 1 46,316,303 (GRCm39) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,181,245 (GRCm39) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,234,532 (GRCm39) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,342,794 (GRCm39) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,214,579 (GRCm39) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,329,894 (GRCm39) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,364,925 (GRCm39) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,395,714 (GRCm39) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,163,506 (GRCm39) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,253,573 (GRCm39) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,307,794 (GRCm39) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,148,462 (GRCm39) missense probably benign
R7676:Dnah7b UTSW 1 46,273,324 (GRCm39) nonsense probably null
R7731:Dnah7b UTSW 1 46,178,905 (GRCm39) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,240,413 (GRCm39) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,176,634 (GRCm39) missense probably benign
R7807:Dnah7b UTSW 1 46,253,527 (GRCm39) missense probably benign
R7895:Dnah7b UTSW 1 46,289,110 (GRCm39) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,178,838 (GRCm39) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,266,163 (GRCm39) missense probably benign
R7946:Dnah7b UTSW 1 46,272,739 (GRCm39) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,282,584 (GRCm39) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,282,525 (GRCm39) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,263,866 (GRCm39) nonsense probably null
R8094:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,272,913 (GRCm39) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,292,671 (GRCm39) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,395,736 (GRCm39) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,179,032 (GRCm39) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,214,456 (GRCm39) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,395,819 (GRCm39) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,227,839 (GRCm39) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,329,875 (GRCm39) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,138,650 (GRCm39) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,155,360 (GRCm39) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,214,598 (GRCm39) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,221,624 (GRCm39) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,392,159 (GRCm39) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,162,806 (GRCm39) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,273,305 (GRCm39) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,230,953 (GRCm39) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,280,236 (GRCm39) missense possibly damaging 0.82
R9009:Dnah7b UTSW 1 46,262,232 (GRCm39) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,282,575 (GRCm39) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,173,674 (GRCm39) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,266,180 (GRCm39) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,181,194 (GRCm39) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,330,038 (GRCm39) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,361,420 (GRCm39) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,272,914 (GRCm39) nonsense probably null
R9392:Dnah7b UTSW 1 46,162,898 (GRCm39) nonsense probably null
R9456:Dnah7b UTSW 1 46,165,953 (GRCm39) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,253,564 (GRCm39) missense probably benign 0.27
R9553:Dnah7b UTSW 1 46,264,956 (GRCm39) missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46,292,621 (GRCm39) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,252,544 (GRCm39) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
RF020:Dnah7b UTSW 1 46,412,421 (GRCm39) missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46,412,458 (GRCm39) nonsense probably null
X0023:Dnah7b UTSW 1 46,342,737 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCTCATTGCTTATTACAGTACATAGC -3'
(R):5'- GAGTCCCTTGGTATAGTGAAGATC -3'

Sequencing Primer
(F):5'- AGGTGAAGCTTCAACAGC -3'
(R):5'- CCTAATACAGGGGAATGCCAG -3'
Posted On 2021-08-31