Incidental Mutation 'R8905:Smarca5'
ID 680035
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8905 (G1)
Quality Score 222.009
Status Validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80713948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 629 (I629K)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably benign
Transcript: ENSMUST00000043359
AA Change: I629K

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: I629K

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,242 V236A probably benign Het
4931408C20Rik A G 1: 26,682,814 V1095A probably damaging Het
Abca15 A T 7: 120,361,548 R744S probably benign Het
Adgra1 T C 7: 139,875,847 S464P probably damaging Het
Arhgap45 T C 10: 80,019,736 V3A probably benign Het
AW554918 T A 18: 25,340,149 S134T probably damaging Het
Bmper A G 9: 23,406,786 E567G probably benign Het
C2cd3 T C 7: 100,424,925 probably null Het
Cars A G 7: 143,586,459 Y170H probably damaging Het
Ccdc173 A G 2: 69,781,760 S175P probably benign Het
Celsr1 A T 15: 85,904,068 probably benign Het
Celsr3 C T 9: 108,841,302 H2351Y probably damaging Het
Cyp2d11 T C 15: 82,390,901 I282V probably benign Het
Dhfr A G 13: 92,357,959 T57A probably damaging Het
Dnah7b A C 1: 46,253,374 Q2973P probably damaging Het
Dnajc5b T C 3: 19,579,020 C136R probably benign Het
Efcab1 A G 16: 14,920,411 I147V possibly damaging Het
Ercc3 T G 18: 32,265,718 D683E possibly damaging Het
Faxc A G 4: 21,982,398 Y279C probably damaging Het
Fbxw7 T C 3: 84,965,327 M191T possibly damaging Het
Fcgbp T A 7: 28,086,509 V457E probably damaging Het
Fip1l1 A T 5: 74,595,963 T539S probably damaging Het
Gabra1 T C 11: 42,147,225 T189A possibly damaging Het
Glg1 T C 8: 111,158,036 D1118G probably damaging Het
Gli3 A G 13: 15,726,531 D1501G probably benign Het
Gm4756 T A 12: 72,619,657 D80V probably damaging Het
Hacd1 A G 2: 14,044,950 I91T possibly damaging Het
Ift22 T C 5: 136,912,891 V159A probably benign Het
Igkv1-110 T A 6: 68,271,086 Y60N probably damaging Het
Inpp5d A G 1: 87,709,626 K502E probably damaging Het
Kcnt2 A T 1: 140,507,729 Q478L possibly damaging Het
Mettl13 A G 1: 162,537,278 F511L probably damaging Het
Mis18bp1 T C 12: 65,133,627 probably null Het
Mrps30 A T 13: 118,386,943 S98T probably benign Het
Muc2 C T 7: 141,693,400 A209V probably benign Het
Nfs1 A T 2: 156,128,583 I270N probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nsmaf A G 4: 6,424,951 S266P probably benign Het
Obscn A G 11: 59,069,958 S3176P probably damaging Het
Olfr1230 A T 2: 89,296,457 L271Q possibly damaging Het
Olfr834 A G 9: 18,988,198 D70G possibly damaging Het
P2ry12 T A 3: 59,217,576 Y226F probably damaging Het
Pabpc2 C A 18: 39,774,651 T323K probably benign Het
Pank2 A G 2: 131,282,726 D71G possibly damaging Het
Patj A T 4: 98,497,175 H393L probably damaging Het
Pde8b A G 13: 95,046,485 V255A probably damaging Het
Plekhs1 T C 19: 56,482,596 W374R probably damaging Het
Ppm1g T C 5: 31,204,093 D313G probably damaging Het
Rnf114 A G 2: 167,511,214 N135S probably benign Het
Rnf43 T G 11: 87,731,125 Y351D probably damaging Het
Robo1 A T 16: 72,742,285 D90V probably damaging Het
Sbds A G 5: 130,248,284 V172A possibly damaging Het
Scamp5 T A 9: 57,445,386 I167F probably benign Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sfxn1 T A 13: 54,092,414 V159E probably damaging Het
Sgsm1 C T 5: 113,273,629 G531R probably benign Het
Slc22a26 T A 19: 7,782,966 I471F probably damaging Het
Slc41a3 T A 6: 90,612,141 M78K probably benign Het
Slc8a1 A T 17: 81,441,655 Y653N probably benign Het
Slco6c1 A T 1: 97,125,666 M170K possibly damaging Het
Smg7 T A 1: 152,840,066 D1099V probably damaging Het
Srbd1 T C 17: 86,001,462 I763V probably benign Het
Stk25 A G 1: 93,629,207 S30P probably damaging Het
Sv2b C T 7: 75,117,711 A646T probably benign Het
Tardbp T C 4: 148,620,636 M167V probably benign Het
Tmem132a T C 19: 10,865,283 N276S probably damaging Het
Ttpa T A 4: 20,028,435 S162T probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Vmn2r3 T A 3: 64,259,274 Y812F probably damaging Het
Yeats2 A G 16: 20,190,394 T463A probably benign Het
Zbtb26 T A 2: 37,436,915 K36N probably benign Het
Zfc3h1 A T 10: 115,423,478 T1652S probably benign Het
Zfp472 G A 17: 32,978,481 C510Y possibly damaging Het
Zfp518a C A 19: 40,914,336 T903K probably damaging Het
Zfp668 T C 7: 127,866,426 T529A probably benign Het
Zfp930 A G 8: 69,228,699 T349A possibly damaging Het
Zmiz2 T G 11: 6,396,840 Y182D probably damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTCAGTGCTTATAAATCACCAC -3'
(R):5'- TACTCATGCAGTTGGCTTTGTC -3'

Sequencing Primer
(F):5'- CAGTGCTTATAAATCACCACAATTC -3'
(R):5'- ATTTTGCTTCTCAGTGTACATGTTTC -3'
Posted On 2021-08-31