Mutagenetix > Incidental Mutation

Incidental Mutation 'R8905:Smarca5'

680035

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

068762-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8905 (G1)

Quality Score

222.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80713948 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 629 (I629K)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably benign
Transcript: ENSMUST00000043359
AA Change: I629K

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: I629K

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.1005

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	C	4: 137,455,242	V236A	probably benign	Het
4931408C20Rik	A	G	1: 26,682,814	V1095A	probably damaging	Het
Abca15	A	T	7: 120,361,548	R744S	probably benign	Het
Adgra1	T	C	7: 139,875,847	S464P	probably damaging	Het
Arhgap45	T	C	10: 80,019,736	V3A	probably benign	Het
AW554918	T	A	18: 25,340,149	S134T	probably damaging	Het
Bmper	A	G	9: 23,406,786	E567G	probably benign	Het
C2cd3	T	C	7: 100,424,925		probably null	Het
Cars	A	G	7: 143,586,459	Y170H	probably damaging	Het
Ccdc173	A	G	2: 69,781,760	S175P	probably benign	Het
Celsr1	A	T	15: 85,904,068		probably benign	Het
Celsr3	C	T	9: 108,841,302	H2351Y	probably damaging	Het
Cyp2d11	T	C	15: 82,390,901	I282V	probably benign	Het
Dhfr	A	G	13: 92,357,959	T57A	probably damaging	Het
Dnah7b	A	C	1: 46,253,374	Q2973P	probably damaging	Het
Dnajc5b	T	C	3: 19,579,020	C136R	probably benign	Het
Efcab1	A	G	16: 14,920,411	I147V	possibly damaging	Het
Ercc3	T	G	18: 32,265,718	D683E	possibly damaging	Het
Faxc	A	G	4: 21,982,398	Y279C	probably damaging	Het
Fbxw7	T	C	3: 84,965,327	M191T	possibly damaging	Het
Fcgbp	T	A	7: 28,086,509	V457E	probably damaging	Het
Fip1l1	A	T	5: 74,595,963	T539S	probably damaging	Het
Gabra1	T	C	11: 42,147,225	T189A	possibly damaging	Het
Glg1	T	C	8: 111,158,036	D1118G	probably damaging	Het
Gli3	A	G	13: 15,726,531	D1501G	probably benign	Het
Gm4756	T	A	12: 72,619,657	D80V	probably damaging	Het
Hacd1	A	G	2: 14,044,950	I91T	possibly damaging	Het
Ift22	T	C	5: 136,912,891	V159A	probably benign	Het
Igkv1-110	T	A	6: 68,271,086	Y60N	probably damaging	Het
Inpp5d	A	G	1: 87,709,626	K502E	probably damaging	Het
Kcnt2	A	T	1: 140,507,729	Q478L	possibly damaging	Het
Mettl13	A	G	1: 162,537,278	F511L	probably damaging	Het
Mis18bp1	T	C	12: 65,133,627		probably null	Het
Mrps30	A	T	13: 118,386,943	S98T	probably benign	Het
Muc2	C	T	7: 141,693,400	A209V	probably benign	Het
Nfs1	A	T	2: 156,128,583	I270N	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nsmaf	A	G	4: 6,424,951	S266P	probably benign	Het
Obscn	A	G	11: 59,069,958	S3176P	probably damaging	Het
Olfr1230	A	T	2: 89,296,457	L271Q	possibly damaging	Het
Olfr834	A	G	9: 18,988,198	D70G	possibly damaging	Het
P2ry12	T	A	3: 59,217,576	Y226F	probably damaging	Het
Pabpc2	C	A	18: 39,774,651	T323K	probably benign	Het
Pank2	A	G	2: 131,282,726	D71G	possibly damaging	Het
Patj	A	T	4: 98,497,175	H393L	probably damaging	Het
Pde8b	A	G	13: 95,046,485	V255A	probably damaging	Het
Plekhs1	T	C	19: 56,482,596	W374R	probably damaging	Het
Ppm1g	T	C	5: 31,204,093	D313G	probably damaging	Het
Rnf114	A	G	2: 167,511,214	N135S	probably benign	Het
Rnf43	T	G	11: 87,731,125	Y351D	probably damaging	Het
Robo1	A	T	16: 72,742,285	D90V	probably damaging	Het
Sbds	A	G	5: 130,248,284	V172A	possibly damaging	Het
Scamp5	T	A	9: 57,445,386	I167F	probably benign	Het
Sec14l5	A	G	16: 5,176,500	E386G	probably damaging	Het
Sfxn1	T	A	13: 54,092,414	V159E	probably damaging	Het
Sgsm1	C	T	5: 113,273,629	G531R	probably benign	Het
Slc22a26	T	A	19: 7,782,966	I471F	probably damaging	Het
Slc41a3	T	A	6: 90,612,141	M78K	probably benign	Het
Slc8a1	A	T	17: 81,441,655	Y653N	probably benign	Het
Slco6c1	A	T	1: 97,125,666	M170K	possibly damaging	Het
Smg7	T	A	1: 152,840,066	D1099V	probably damaging	Het
Srbd1	T	C	17: 86,001,462	I763V	probably benign	Het
Stk25	A	G	1: 93,629,207	S30P	probably damaging	Het
Sv2b	C	T	7: 75,117,711	A646T	probably benign	Het
Tardbp	T	C	4: 148,620,636	M167V	probably benign	Het
Tmem132a	T	C	19: 10,865,283	N276S	probably damaging	Het
Ttpa	T	A	4: 20,028,435	S162T	probably benign	Het
Usp13	T	C	3: 32,881,423	Y333H	probably damaging	Het
Vmn2r3	T	A	3: 64,259,274	Y812F	probably damaging	Het
Yeats2	A	G	16: 20,190,394	T463A	probably benign	Het
Zbtb26	T	A	2: 37,436,915	K36N	probably benign	Het
Zfc3h1	A	T	10: 115,423,478	T1652S	probably benign	Het
Zfp472	G	A	17: 32,978,481	C510Y	possibly damaging	Het
Zfp518a	C	A	19: 40,914,336	T903K	probably damaging	Het
Zfp668	T	C	7: 127,866,426	T529A	probably benign	Het
Zfp930	A	G	8: 69,228,699	T349A	possibly damaging	Het
Zmiz2	T	G	11: 6,396,840	Y182D	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCTCAGTGCTTATAAATCACCAC -3'
(R):5'- TACTCATGCAGTTGGCTTTGTC -3'

Sequencing Primer
(F):5'- CAGTGCTTATAAATCACCACAATTC -3'
(R):5'- ATTTTGCTTCTCAGTGTACATGTTTC -3'

Posted On

2021-08-31