Incidental Mutation 'R8905:Gli3'
ID680049
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8905 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15726531 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1501 (D1501G)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: D1501G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: D1501G

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,242 V236A probably benign Het
4931408C20Rik A G 1: 26,682,814 V1095A probably damaging Het
Abca15 A T 7: 120,361,548 R744S probably benign Het
Adgra1 T C 7: 139,875,847 S464P probably damaging Het
Arhgap45 T C 10: 80,019,736 V3A probably benign Het
AW554918 T A 18: 25,340,149 S134T probably damaging Het
Bmper A G 9: 23,406,786 E567G probably benign Het
C2cd3 T C 7: 100,424,925 probably null Het
Cars A G 7: 143,586,459 Y170H probably damaging Het
Ccdc173 A G 2: 69,781,760 S175P probably benign Het
Celsr3 C T 9: 108,841,302 H2351Y probably damaging Het
Cyp2d11 T C 15: 82,390,901 I282V probably benign Het
Dhfr A G 13: 92,357,959 T57A probably damaging Het
Dnah7b A C 1: 46,253,374 Q2973P probably damaging Het
Dnajc5b T C 3: 19,579,020 C136R probably benign Het
Efcab1 A G 16: 14,920,411 I147V possibly damaging Het
Ercc3 T G 18: 32,265,718 D683E possibly damaging Het
Faxc A G 4: 21,982,398 Y279C probably damaging Het
Fbxw7 T C 3: 84,965,327 M191T possibly damaging Het
Fcgbp T A 7: 28,086,509 V457E probably damaging Het
Fip1l1 A T 5: 74,595,963 T539S probably damaging Het
Gabra1 T C 11: 42,147,225 T189A possibly damaging Het
Glg1 T C 8: 111,158,036 D1118G probably damaging Het
Gm4756 T A 12: 72,619,657 D80V probably damaging Het
Hacd1 A G 2: 14,044,950 I91T possibly damaging Het
Ift22 T C 5: 136,912,891 V159A probably benign Het
Igkv1-110 T A 6: 68,271,086 Y60N probably damaging Het
Inpp5d A G 1: 87,709,626 K502E probably damaging Het
Kcnt2 A T 1: 140,507,729 Q478L possibly damaging Het
Mettl13 A G 1: 162,537,278 F511L probably damaging Het
Mis18bp1 T C 12: 65,133,627 probably null Het
Mrps30 A T 13: 118,386,943 S98T probably benign Het
Muc2 C T 7: 141,693,400 A209V probably benign Het
Nfs1 A T 2: 156,128,583 I270N probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nsmaf A G 4: 6,424,951 S266P probably benign Het
Obscn A G 11: 59,069,958 S3176P probably damaging Het
Olfr1230 A T 2: 89,296,457 L271Q possibly damaging Het
Olfr834 A G 9: 18,988,198 D70G possibly damaging Het
P2ry12 T A 3: 59,217,576 Y226F probably damaging Het
Pabpc2 C A 18: 39,774,651 T323K probably benign Het
Pank2 A G 2: 131,282,726 D71G possibly damaging Het
Patj A T 4: 98,497,175 H393L probably damaging Het
Pde8b A G 13: 95,046,485 V255A probably damaging Het
Plekhs1 T C 19: 56,482,596 W374R probably damaging Het
Ppm1g T C 5: 31,204,093 D313G probably damaging Het
Rnf114 A G 2: 167,511,214 N135S probably benign Het
Rnf43 T G 11: 87,731,125 Y351D probably damaging Het
Robo1 A T 16: 72,742,285 D90V probably damaging Het
Sbds A G 5: 130,248,284 V172A possibly damaging Het
Scamp5 T A 9: 57,445,386 I167F probably benign Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sfxn1 T A 13: 54,092,414 V159E probably damaging Het
Sgsm1 C T 5: 113,273,629 G531R probably benign Het
Slc22a26 T A 19: 7,782,966 I471F probably damaging Het
Slc41a3 T A 6: 90,612,141 M78K probably benign Het
Slc8a1 A T 17: 81,441,655 Y653N probably benign Het
Slco6c1 A T 1: 97,125,666 M170K possibly damaging Het
Smarca5 A T 8: 80,713,948 I629K probably benign Het
Smg7 T A 1: 152,840,066 D1099V probably damaging Het
Srbd1 T C 17: 86,001,462 I763V probably benign Het
Stk25 A G 1: 93,629,207 S30P probably damaging Het
Sv2b C T 7: 75,117,711 A646T probably benign Het
Tardbp T C 4: 148,620,636 M167V probably benign Het
Tmem132a T C 19: 10,865,283 N276S probably damaging Het
Ttpa T A 4: 20,028,435 S162T probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Vmn2r3 T A 3: 64,259,274 Y812F probably damaging Het
Yeats2 A G 16: 20,190,394 T463A probably benign Het
Zbtb26 T A 2: 37,436,915 K36N probably benign Het
Zfc3h1 A T 10: 115,423,478 T1652S probably benign Het
Zfp472 G A 17: 32,978,481 C510Y possibly damaging Het
Zfp518a C A 19: 40,914,336 T903K probably damaging Het
Zfp668 T C 7: 127,866,426 T529A probably benign Het
Zfp930 A G 8: 69,228,699 T349A possibly damaging Het
Zmiz2 T G 11: 6,396,840 Y182D probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8247:Gli3 UTSW 13 15726775 missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGTGCAGAATTATTCCGGTC -3'
(R):5'- TCTTCTGCAAGGGAGGTCAG -3'

Sequencing Primer
(F):5'- GCAGAATTATTCCGGTCAGTTC -3'
(R):5'- ATATCCCCGATAGCCATGTTGGTG -3'
Posted On2021-08-31