Mutagenetix > Incidental Mutation

Incidental Mutation 'R8906:Hoxd13'

680086

Institutional Source

Beutler Lab

Gene Symbol

Hoxd13

Ensembl Gene

ENSMUSG00000001819

Gene Name

homeobox D13

Synonyms

Hox-4.8, spdh

MMRRC Submission

068699-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.673) question?

Stock #

R8906 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74668310-74671599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74669922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 269 (Y269C)

Ref Sequence

ENSEMBL: ENSMUSP00000001872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001872]

AlphaFold

P70217

Predicted Effect

SMART Domains

Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: Y269C

Domain	Start	End	E-Value	Type
low complexity region	14	34	N/A	INTRINSIC
Pfam:HoxA13_N	75	177	4e-18	PFAM
HOX	272	334	4.33e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	C	19: 3,716,686	N91T	possibly damaging	Het
2510009E07Rik	CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA	CCGGA	16: 21,653,398		probably null	Het
4932414N04Rik	A	G	2: 68,732,154	D375G	possibly damaging	Het
4932415D10Rik	T	C	10: 82,286,545	T3544A	probably benign	Het
Adad2	C	A	8: 119,612,986	P69Q	probably benign	Het
Adamts3	G	A	5: 89,677,716	T1088I	probably damaging	Het
Ank2	A	G	3: 126,933,071	V858A	probably benign	Het
Ankrd13a	A	G	5: 114,801,737	N475S	probably benign	Het
Barhl2	G	A	5: 106,455,486	T269I	probably benign	Het
Boc	G	A	16: 44,503,568	R157W		Het
Bsn	G	T	9: 108,107,553	P3101T	unknown	Het
Catsperb	C	A	12: 101,520,645	A477E	possibly damaging	Het
Ccser1	T	A	6: 61,810,858	I220K	probably benign	Het
Cd200r3	A	T	16: 44,957,739	I242F	possibly damaging	Het
Cdc34b	A	C	11: 94,742,085	D37A	probably damaging	Het
Chek2	A	G	5: 110,865,592		probably benign	Het
Cngb1	A	T	8: 95,263,108	V792D	probably damaging	Het
Cops7a	T	C	6: 124,962,408	K93E	possibly damaging	Het
Crispld1	T	C	1: 17,750,771	I345T	possibly damaging	Het
Dgkd	A	G	1: 87,941,435	D1170G	probably damaging	Het
Dhx35	A	G	2: 158,806,998	T115A	possibly damaging	Het
Dnaic1	G	A	4: 41,625,125	R363H	probably benign	Het
Dnmbp	T	A	19: 43,890,242	Q130L	probably benign	Het
Egfr	A	G	11: 16,911,635	Y1138C	probably damaging	Het
Elf3	A	T	1: 135,254,940	L329Q	probably damaging	Het
Enkur	A	G	2: 21,196,757	M39T	probably benign	Het
Epha7	T	C	4: 28,821,615	I260T	probably damaging	Het
Fbxo28	A	T	1: 182,317,069	I310K	probably damaging	Het
Fga	C	A	3: 83,031,804	N495K	probably benign	Het
Galnt6	T	C	15: 100,703,366	D344G	probably damaging	Het
Gm572	A	G	4: 148,666,833	Q221R	probably benign	Het
Gm6205	G	T	5: 94,683,554	R140L	possibly damaging	Het
Gpa33	G	A	1: 166,146,647	A18T	probably benign	Het
Gpatch11	C	T	17: 78,837,860	T6I	probably benign	Het
Gpr84	T	A	15: 103,309,198	S151C	probably damaging	Het
H2-M11	T	A	17: 36,548,959	Y281*	probably null	Het
Hadh	T	C	3: 131,245,242	N155S	probably benign	Het
Iars	T	A	13: 49,728,701	C1074S	probably benign	Het
Ibtk	G	T	9: 85,743,404	H98N	possibly damaging	Het
Igsf10	C	T	3: 59,326,318	G1665R	probably benign	Het
Inpp5d	A	G	1: 87,697,615		probably benign	Het
Ipo9	A	C	1: 135,394,213	V593G	probably damaging	Het
Irx3	T	C	8: 91,800,287	D263G	possibly damaging	Het
Kif13a	A	G	13: 46,773,678	V1179A	probably benign	Het
Lrrc4c	T	C	2: 97,630,048	Y340H	probably benign	Het
Lysmd1	A	G	3: 95,137,908	D155G	probably damaging	Het
Micalcl	T	A	7: 112,381,464	I105N	probably damaging	Het
Mob2	A	T	7: 142,009,524	L66Q	probably damaging	Het
Myh1	A	G	11: 67,205,913	S337G	probably benign	Het
Neb	T	C	2: 52,206,247	D1002G	probably benign	Het
Nebl	A	T	2: 17,378,117	N116K	probably benign	Het
Nkx2-6	T	C	14: 69,175,174	S264P	probably benign	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nlrp4e	A	G	7: 23,321,131	T348A	possibly damaging	Het
Nomo1	A	T	7: 46,072,580	I982F	probably benign	Het
Olfr16	A	G	1: 172,956,619		probably benign	Het
Olfr348	A	T	2: 36,786,609	Y28F	probably benign	Het
Olfr739	T	G	14: 50,424,834	F105C	probably damaging	Het
Olfr936	A	G	9: 39,046,781	F213L	possibly damaging	Het
Palld	A	G	8: 61,550,164		probably null	Het
Pcdh7	A	G	5: 57,721,812	Y903C	probably damaging	Het
Pknox2	G	A	9: 36,892,871	T460M	possibly damaging	Het
Ppm1h	C	T	10: 122,878,546	T330I	probably damaging	Het
Ppp2r2b	C	T	18: 42,688,334	R253H	probably damaging	Het
Prr18	G	A	17: 8,341,644	A211T	probably benign	Het
Ptgs2	A	G	1: 150,104,108	I321M		Het
Rara	G	T	11: 98,970,163	R159L	probably damaging	Het
Rasa4	T	A	5: 136,104,592	I635N	probably benign	Het
Rxfp2	A	T	5: 150,066,423	H423L	possibly damaging	Het
Scn4b	A	G	9: 45,147,871	I147V	possibly damaging	Het
Scrn3	G	A	2: 73,331,008	V313I	probably benign	Het
Scrn3	C	A	2: 73,331,011	P314T	possibly damaging	Het
Sh2b1	A	G	7: 126,471,120		probably null	Het
Slc26a10	T	C	10: 127,180,590	Q3R	probably benign	Het
Slitrk1	A	G	14: 108,911,707	I524T	probably damaging	Het
Smcp	T	A	3: 92,584,223	N106Y	unknown	Het
St8sia5	G	A	18: 77,248,476	V202M	probably damaging	Het
Stxbp5l	A	T	16: 37,208,164	D512E	probably damaging	Het
Tas1r2	A	G	4: 139,669,735	E795G	probably damaging	Het
Tdrd1	T	A	19: 56,842,713	V320D	probably damaging	Het
Tmem71	T	A	15: 66,532,757	I261L	probably benign	Het
Tns2	T	C	15: 102,111,604	L643P	probably damaging	Het
Upf1	G	A	8: 70,334,165	Q890*	probably null	Het
Usp43	A	T	11: 67,891,481	H370Q	possibly damaging	Het
Vmn1r236	T	A	17: 21,287,094	I158N	possibly damaging	Het
Vmn2r98	T	A	17: 19,066,270	N343K	probably benign	Het
Vwa8	T	C	14: 79,092,375	S1216P	probably benign	Het
Yars	A	C	4: 129,196,954	D97A	probably damaging	Het
Zer1	G	A	2: 30,111,023	H129Y	probably benign	Het
Zfat	C	T	15: 68,084,555	D1143N	possibly damaging	Het

Other mutations in Hoxd13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03108:Hoxd13	APN	2	74670096	missense	probably damaging	1.00
R1722:Hoxd13	UTSW	2	74670045	missense	probably benign	0.34
R2163:Hoxd13	UTSW	2	74669069	missense	possibly damaging	0.82
R4116:Hoxd13	UTSW	2	74668488	missense	possibly damaging	0.93
R4400:Hoxd13	UTSW	2	74670015	missense	probably damaging	1.00
R4424:Hoxd13	UTSW	2	74669957	nonsense	probably null
R4938:Hoxd13	UTSW	2	74668683	missense	probably benign	0.26
R5535:Hoxd13	UTSW	2	74668797	missense	probably damaging	0.99
R7054:Hoxd13	UTSW	2	74669025	missense	probably damaging	1.00
R7069:Hoxd13	UTSW	2	74669024	missense	probably damaging	1.00
R7677:Hoxd13	UTSW	2	74668565	missense	probably benign	0.39
R8329:Hoxd13	UTSW	2	74668317	missense	probably benign	0.06
R9130:Hoxd13	UTSW	2	74669038	missense	probably benign	0.02
R9386:Hoxd13	UTSW	2	74668983	missense	probably damaging	1.00
R9803:Hoxd13	UTSW	2	74668903	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATTAGCCTTTGTCTCAAAGTGC -3'
(R):5'- CAGGAGACAGTGTCTTTGAGC -3'

Sequencing Primer
(F):5'- GCCTTTGTCTCAAAGTGCAAATAGTC -3'
(R):5'- AGACAGTGTCTTTGAGCTTGGAGAC -3'

Posted On

2021-08-31