Incidental Mutation 'R8906:Fga'
ID680090
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R8906 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83031804 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 495 (N495K)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
AA Change: N495K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: N495K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166581
AA Change: N495K

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: N495K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A C 19: 3,716,686 N91T possibly damaging Het
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
4932414N04Rik A G 2: 68,732,154 D375G possibly damaging Het
4932415D10Rik T C 10: 82,286,545 T3544A probably benign Het
Adad2 C A 8: 119,612,986 P69Q probably benign Het
Adamts3 G A 5: 89,677,716 T1088I probably damaging Het
Ank2 A G 3: 126,933,071 V858A probably benign Het
Ankrd13a A G 5: 114,801,737 N475S probably benign Het
Barhl2 G A 5: 106,455,486 T269I probably benign Het
Boc G A 16: 44,503,568 R157W Het
Bsn G T 9: 108,107,553 P3101T unknown Het
Catsperb C A 12: 101,520,645 A477E possibly damaging Het
Ccser1 T A 6: 61,810,858 I220K probably benign Het
Cd200r3 A T 16: 44,957,739 I242F possibly damaging Het
Cdc34b A C 11: 94,742,085 D37A probably damaging Het
Chek2 A G 5: 110,865,592 probably benign Het
Cngb1 A T 8: 95,263,108 V792D probably damaging Het
Cops7a T C 6: 124,962,408 K93E possibly damaging Het
Crispld1 T C 1: 17,750,771 I345T possibly damaging Het
Dgkd A G 1: 87,941,435 D1170G probably damaging Het
Dhx35 A G 2: 158,806,998 T115A possibly damaging Het
Dnaic1 G A 4: 41,625,125 R363H probably benign Het
Dnmbp T A 19: 43,890,242 Q130L probably benign Het
Egfr A G 11: 16,911,635 Y1138C probably damaging Het
Elf3 A T 1: 135,254,940 L329Q probably damaging Het
Enkur A G 2: 21,196,757 M39T probably benign Het
Epha7 T C 4: 28,821,615 I260T probably damaging Het
Fbxo28 A T 1: 182,317,069 I310K probably damaging Het
Galnt6 T C 15: 100,703,366 D344G probably damaging Het
Gm572 A G 4: 148,666,833 Q221R probably benign Het
Gm6205 G T 5: 94,683,554 R140L possibly damaging Het
Gpa33 G A 1: 166,146,647 A18T probably benign Het
Gpatch11 C T 17: 78,837,860 T6I probably benign Het
Gpr84 T A 15: 103,309,198 S151C probably damaging Het
H2-M11 T A 17: 36,548,959 Y281* probably null Het
Hadh T C 3: 131,245,242 N155S probably benign Het
Hoxd13 A G 2: 74,669,922 Y269C Het
Iars T A 13: 49,728,701 C1074S probably benign Het
Ibtk G T 9: 85,743,404 H98N possibly damaging Het
Igsf10 C T 3: 59,326,318 G1665R probably benign Het
Ipo9 A C 1: 135,394,213 V593G probably damaging Het
Irx3 T C 8: 91,800,287 D263G possibly damaging Het
Kif13a A G 13: 46,773,678 V1179A probably benign Het
Lrrc4c T C 2: 97,630,048 Y340H probably benign Het
Lysmd1 A G 3: 95,137,908 D155G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Mob2 A T 7: 142,009,524 L66Q probably damaging Het
Myh1 A G 11: 67,205,913 S337G probably benign Het
Neb T C 2: 52,206,247 D1002G probably benign Het
Nebl A T 2: 17,378,117 N116K probably benign Het
Nkx2-6 T C 14: 69,175,174 S264P probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4e A G 7: 23,321,131 T348A possibly damaging Het
Nomo1 A T 7: 46,072,580 I982F probably benign Het
Olfr16 A G 1: 172,956,619 probably benign Het
Olfr348 A T 2: 36,786,609 Y28F probably benign Het
Olfr739 T G 14: 50,424,834 F105C probably damaging Het
Olfr936 A G 9: 39,046,781 F213L possibly damaging Het
Palld A G 8: 61,550,164 probably null Het
Pcdh7 A G 5: 57,721,812 Y903C probably damaging Het
Pknox2 G A 9: 36,892,871 T460M possibly damaging Het
Ppm1h C T 10: 122,878,546 T330I probably damaging Het
Ppp2r2b C T 18: 42,688,334 R253H probably damaging Het
Prr18 G A 17: 8,341,644 A211T probably benign Het
Ptgs2 A G 1: 150,104,108 I321M Het
Rara G T 11: 98,970,163 R159L probably damaging Het
Rasa4 T A 5: 136,104,592 I635N probably benign Het
Rxfp2 A T 5: 150,066,423 H423L possibly damaging Het
Scn4b A G 9: 45,147,871 I147V possibly damaging Het
Scrn3 G A 2: 73,331,008 V313I probably benign Het
Scrn3 C A 2: 73,331,011 P314T possibly damaging Het
Sh2b1 A G 7: 126,471,120 probably null Het
Slc26a10 T C 10: 127,180,590 Q3R probably benign Het
Slitrk1 A G 14: 108,911,707 I524T probably damaging Het
Smcp T A 3: 92,584,223 N106Y unknown Het
St8sia5 G A 18: 77,248,476 V202M probably damaging Het
Stxbp5l A T 16: 37,208,164 D512E probably damaging Het
Tas1r2 A G 4: 139,669,735 E795G probably damaging Het
Tdrd1 T A 19: 56,842,713 V320D probably damaging Het
Tmem71 T A 15: 66,532,757 I261L probably benign Het
Tns2 T C 15: 102,111,604 L643P probably damaging Het
Upf1 G A 8: 70,334,165 Q890* probably null Het
Usp43 A T 11: 67,891,481 H370Q possibly damaging Het
Vmn1r236 T A 17: 21,287,094 I158N possibly damaging Het
Vmn2r98 T A 17: 19,066,270 N343K probably benign Het
Vwa8 T C 14: 79,092,375 S1216P probably benign Het
Yars A C 4: 129,196,954 D97A probably damaging Het
Zer1 G A 2: 30,111,023 H129Y probably benign Het
Zfat C T 15: 68,084,555 D1143N possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
R8523:Fga UTSW 3 83030851 missense probably damaging 1.00
R8801:Fga UTSW 3 83030881 missense possibly damaging 0.89
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTGATCACCTCGGATGATGG -3'
(R):5'- CTCCCGAAAGTTAAGTGTCGATAC -3'

Sequencing Primer
(F):5'- ATCACCTCGGATGATGGCTCAG -3'
(R):5'- CCGAAAGTTAAGTGTCGATACCTCTC -3'
Posted On2021-08-31