Incidental Mutation 'R8906:Upf1'
ID 680116
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, PNORF-1, Rent1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R8906 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70331525-70353278 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 70334165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 890 (Q890*)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably null
Transcript: ENSMUST00000075666
AA Change: Q901*
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: Q901*

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207684
Predicted Effect probably null
Transcript: ENSMUST00000215817
AA Change: Q890*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A C 19: 3,716,686 N91T possibly damaging Het
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
4932414N04Rik A G 2: 68,732,154 D375G possibly damaging Het
4932415D10Rik T C 10: 82,286,545 T3544A probably benign Het
Adad2 C A 8: 119,612,986 P69Q probably benign Het
Adamts3 G A 5: 89,677,716 T1088I probably damaging Het
Ank2 A G 3: 126,933,071 V858A probably benign Het
Ankrd13a A G 5: 114,801,737 N475S probably benign Het
Barhl2 G A 5: 106,455,486 T269I probably benign Het
Boc G A 16: 44,503,568 R157W Het
Bsn G T 9: 108,107,553 P3101T unknown Het
Catsperb C A 12: 101,520,645 A477E possibly damaging Het
Ccser1 T A 6: 61,810,858 I220K probably benign Het
Cd200r3 A T 16: 44,957,739 I242F possibly damaging Het
Cdc34b A C 11: 94,742,085 D37A probably damaging Het
Chek2 A G 5: 110,865,592 probably benign Het
Cngb1 A T 8: 95,263,108 V792D probably damaging Het
Cops7a T C 6: 124,962,408 K93E possibly damaging Het
Crispld1 T C 1: 17,750,771 I345T possibly damaging Het
Dgkd A G 1: 87,941,435 D1170G probably damaging Het
Dhx35 A G 2: 158,806,998 T115A possibly damaging Het
Dnaic1 G A 4: 41,625,125 R363H probably benign Het
Dnmbp T A 19: 43,890,242 Q130L probably benign Het
Egfr A G 11: 16,911,635 Y1138C probably damaging Het
Elf3 A T 1: 135,254,940 L329Q probably damaging Het
Enkur A G 2: 21,196,757 M39T probably benign Het
Epha7 T C 4: 28,821,615 I260T probably damaging Het
Fbxo28 A T 1: 182,317,069 I310K probably damaging Het
Fga C A 3: 83,031,804 N495K probably benign Het
Galnt6 T C 15: 100,703,366 D344G probably damaging Het
Gm572 A G 4: 148,666,833 Q221R probably benign Het
Gm6205 G T 5: 94,683,554 R140L possibly damaging Het
Gpa33 G A 1: 166,146,647 A18T probably benign Het
Gpatch11 C T 17: 78,837,860 T6I probably benign Het
Gpr84 T A 15: 103,309,198 S151C probably damaging Het
H2-M11 T A 17: 36,548,959 Y281* probably null Het
Hadh T C 3: 131,245,242 N155S probably benign Het
Hoxd13 A G 2: 74,669,922 Y269C Het
Iars T A 13: 49,728,701 C1074S probably benign Het
Ibtk G T 9: 85,743,404 H98N possibly damaging Het
Igsf10 C T 3: 59,326,318 G1665R probably benign Het
Inpp5d A G 1: 87,697,615 probably benign Het
Ipo9 A C 1: 135,394,213 V593G probably damaging Het
Irx3 T C 8: 91,800,287 D263G possibly damaging Het
Kif13a A G 13: 46,773,678 V1179A probably benign Het
Lrrc4c T C 2: 97,630,048 Y340H probably benign Het
Lysmd1 A G 3: 95,137,908 D155G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Mob2 A T 7: 142,009,524 L66Q probably damaging Het
Myh1 A G 11: 67,205,913 S337G probably benign Het
Neb T C 2: 52,206,247 D1002G probably benign Het
Nebl A T 2: 17,378,117 N116K probably benign Het
Nkx2-6 T C 14: 69,175,174 S264P probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4e A G 7: 23,321,131 T348A possibly damaging Het
Nomo1 A T 7: 46,072,580 I982F probably benign Het
Olfr16 A G 1: 172,956,619 probably benign Het
Olfr348 A T 2: 36,786,609 Y28F probably benign Het
Olfr739 T G 14: 50,424,834 F105C probably damaging Het
Olfr936 A G 9: 39,046,781 F213L possibly damaging Het
Palld A G 8: 61,550,164 probably null Het
Pcdh7 A G 5: 57,721,812 Y903C probably damaging Het
Pknox2 G A 9: 36,892,871 T460M possibly damaging Het
Ppm1h C T 10: 122,878,546 T330I probably damaging Het
Ppp2r2b C T 18: 42,688,334 R253H probably damaging Het
Prr18 G A 17: 8,341,644 A211T probably benign Het
Ptgs2 A G 1: 150,104,108 I321M Het
Rara G T 11: 98,970,163 R159L probably damaging Het
Rasa4 T A 5: 136,104,592 I635N probably benign Het
Rxfp2 A T 5: 150,066,423 H423L possibly damaging Het
Scn4b A G 9: 45,147,871 I147V possibly damaging Het
Scrn3 G A 2: 73,331,008 V313I probably benign Het
Scrn3 C A 2: 73,331,011 P314T possibly damaging Het
Sh2b1 A G 7: 126,471,120 probably null Het
Slc26a10 T C 10: 127,180,590 Q3R probably benign Het
Slitrk1 A G 14: 108,911,707 I524T probably damaging Het
Smcp T A 3: 92,584,223 N106Y unknown Het
St8sia5 G A 18: 77,248,476 V202M probably damaging Het
Stxbp5l A T 16: 37,208,164 D512E probably damaging Het
Tas1r2 A G 4: 139,669,735 E795G probably damaging Het
Tdrd1 T A 19: 56,842,713 V320D probably damaging Het
Tmem71 T A 15: 66,532,757 I261L probably benign Het
Tns2 T C 15: 102,111,604 L643P probably damaging Het
Usp43 A T 11: 67,891,481 H370Q possibly damaging Het
Vmn1r236 T A 17: 21,287,094 I158N possibly damaging Het
Vmn2r98 T A 17: 19,066,270 N343K probably benign Het
Vwa8 T C 14: 79,092,375 S1216P probably benign Het
Yars A C 4: 129,196,954 D97A probably damaging Het
Zer1 G A 2: 30,111,023 H129Y probably benign Het
Zfat C T 15: 68,084,555 D1143N possibly damaging Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
Nanosphere UTSW 8 70344262 missense probably benign 0.01
Particulate UTSW 8 70337025 missense probably damaging 0.96
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0477:Upf1 UTSW 8 70334080 missense probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1018:Upf1 UTSW 8 70338906 missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R2425:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6056:Upf1 UTSW 8 70333037 missense probably damaging 0.98
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
R7759:Upf1 UTSW 8 70334080 missense probably benign
R7783:Upf1 UTSW 8 70352858 missense probably benign 0.11
R8079:Upf1 UTSW 8 70338884 critical splice donor site probably null
R8192:Upf1 UTSW 8 70340644 missense probably benign 0.03
R8544:Upf1 UTSW 8 70337052 missense probably damaging 1.00
R8738:Upf1 UTSW 8 70333322 missense probably benign 0.01
R8738:Upf1 UTSW 8 70333323 missense probably benign 0.06
R8826:Upf1 UTSW 8 70338280 missense probably benign
R8876:Upf1 UTSW 8 70344268 missense possibly damaging 0.92
R8911:Upf1 UTSW 8 70338437 missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70340024 missense probably benign
R9425:Upf1 UTSW 8 70339353 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAATGTGTCAGTCAACAGC -3'
(R):5'- TAGAGAGCTGCGAATCACAC -3'

Sequencing Primer
(F):5'- TGTGTCAGTCAACAGCAGCAG -3'
(R):5'- AGAGCTCTCACTGCTGCTTAAGTG -3'
Posted On 2021-08-31