Incidental Mutation 'R8906:Upf1'
ID 680116
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
MMRRC Submission 068699-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R8906 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 70786815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 890 (Q890*)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably null
Transcript: ENSMUST00000075666
AA Change: Q901*
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: Q901*

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207684
Predicted Effect probably null
Transcript: ENSMUST00000215817
AA Change: Q890*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A C 19: 3,766,686 (GRCm39) N91T possibly damaging Het
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,472,148 (GRCm39) probably null Het
4932414N04Rik A G 2: 68,562,498 (GRCm39) D375G possibly damaging Het
Adad2 C A 8: 120,339,725 (GRCm39) P69Q probably benign Het
Adamts3 G A 5: 89,825,575 (GRCm39) T1088I probably damaging Het
Ank2 A G 3: 126,726,720 (GRCm39) V858A probably benign Het
Ankrd13a A G 5: 114,939,798 (GRCm39) N475S probably benign Het
Barhl2 G A 5: 106,603,352 (GRCm39) T269I probably benign Het
Boc G A 16: 44,323,931 (GRCm39) R157W Het
Bsn G T 9: 107,984,752 (GRCm39) P3101T unknown Het
Catsperb C A 12: 101,486,904 (GRCm39) A477E possibly damaging Het
Ccser1 T A 6: 61,787,842 (GRCm39) I220K probably benign Het
Cd200r3 A T 16: 44,778,102 (GRCm39) I242F possibly damaging Het
Cdc34b A C 11: 94,632,911 (GRCm39) D37A probably damaging Het
Chek2 A G 5: 111,013,458 (GRCm39) probably benign Het
Cngb1 A T 8: 95,989,736 (GRCm39) V792D probably damaging Het
Cops7a T C 6: 124,939,371 (GRCm39) K93E possibly damaging Het
Crispld1 T C 1: 17,820,995 (GRCm39) I345T possibly damaging Het
Dgkd A G 1: 87,869,157 (GRCm39) D1170G probably damaging Het
Dhx35 A G 2: 158,648,918 (GRCm39) T115A possibly damaging Het
Dnai1 G A 4: 41,625,125 (GRCm39) R363H probably benign Het
Dnmbp T A 19: 43,878,681 (GRCm39) Q130L probably benign Het
Egfr A G 11: 16,861,635 (GRCm39) Y1138C probably damaging Het
Elf3 A T 1: 135,182,678 (GRCm39) L329Q probably damaging Het
Enkur A G 2: 21,201,568 (GRCm39) M39T probably benign Het
Epha7 T C 4: 28,821,615 (GRCm39) I260T probably damaging Het
Fbxo28 A T 1: 182,144,634 (GRCm39) I310K probably damaging Het
Fga C A 3: 82,939,111 (GRCm39) N495K probably benign Het
Galnt6 T C 15: 100,601,247 (GRCm39) D344G probably damaging Het
Gm572 A G 4: 148,751,290 (GRCm39) Q221R probably benign Het
Gpa33 G A 1: 165,974,216 (GRCm39) A18T probably benign Het
Gpatch11 C T 17: 79,145,289 (GRCm39) T6I probably benign Het
Gpr84 T A 15: 103,217,625 (GRCm39) S151C probably damaging Het
H2-M11 T A 17: 36,859,851 (GRCm39) Y281* probably null Het
Hadh T C 3: 131,038,891 (GRCm39) N155S probably benign Het
Hoxd13 A G 2: 74,500,266 (GRCm39) Y269C Het
Iars1 T A 13: 49,882,177 (GRCm39) C1074S probably benign Het
Ibtk G T 9: 85,625,457 (GRCm39) H98N possibly damaging Het
Igsf10 C T 3: 59,233,739 (GRCm39) G1665R probably benign Het
Inpp5d A G 1: 87,625,337 (GRCm39) probably benign Het
Ipo9 A C 1: 135,321,951 (GRCm39) V593G probably damaging Het
Irx3 T C 8: 92,526,915 (GRCm39) D263G possibly damaging Het
Kif13a A G 13: 46,927,154 (GRCm39) V1179A probably benign Het
Lrrc4c T C 2: 97,460,393 (GRCm39) Y340H probably benign Het
Lysmd1 A G 3: 95,045,219 (GRCm39) D155G probably damaging Het
Mical2 T A 7: 111,980,671 (GRCm39) I105N probably damaging Het
Mob2 A T 7: 141,563,261 (GRCm39) L66Q probably damaging Het
Myh1 A G 11: 67,096,739 (GRCm39) S337G probably benign Het
Neb T C 2: 52,096,259 (GRCm39) D1002G probably benign Het
Nebl A T 2: 17,382,928 (GRCm39) N116K probably benign Het
Nkx2-6 T C 14: 69,412,623 (GRCm39) S264P probably benign Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nlrp4e A G 7: 23,020,556 (GRCm39) T348A possibly damaging Het
Nomo1 A T 7: 45,722,004 (GRCm39) I982F probably benign Het
Or10j5 A G 1: 172,784,186 (GRCm39) probably benign Het
Or11g24 T G 14: 50,662,291 (GRCm39) F105C probably damaging Het
Or1j19 A T 2: 36,676,621 (GRCm39) Y28F probably benign Het
Or8g22 A G 9: 38,958,077 (GRCm39) F213L possibly damaging Het
Palld A G 8: 62,003,198 (GRCm39) probably null Het
Pcdh7 A G 5: 57,879,154 (GRCm39) Y903C probably damaging Het
Pknox2 G A 9: 36,804,167 (GRCm39) T460M possibly damaging Het
Ppm1h C T 10: 122,714,451 (GRCm39) T330I probably damaging Het
Ppp2r2b C T 18: 42,821,399 (GRCm39) R253H probably damaging Het
Pramel58 G T 5: 94,831,413 (GRCm39) R140L possibly damaging Het
Prr18 G A 17: 8,560,476 (GRCm39) A211T probably benign Het
Ptgs2 A G 1: 149,979,859 (GRCm39) I321M Het
Rara G T 11: 98,860,989 (GRCm39) R159L probably damaging Het
Rasa4 T A 5: 136,133,446 (GRCm39) I635N probably benign Het
Rxfp2 A T 5: 149,989,888 (GRCm39) H423L possibly damaging Het
Scn4b A G 9: 45,059,169 (GRCm39) I147V possibly damaging Het
Scrn3 G A 2: 73,161,352 (GRCm39) V313I probably benign Het
Scrn3 C A 2: 73,161,355 (GRCm39) P314T possibly damaging Het
Sh2b1 A G 7: 126,070,292 (GRCm39) probably null Het
Slc26a10 T C 10: 127,016,459 (GRCm39) Q3R probably benign Het
Slitrk1 A G 14: 109,149,139 (GRCm39) I524T probably damaging Het
Smcp T A 3: 92,491,530 (GRCm39) N106Y unknown Het
Spata31h1 T C 10: 82,122,379 (GRCm39) T3544A probably benign Het
St8sia5 G A 18: 77,336,172 (GRCm39) V202M probably damaging Het
Stxbp5l A T 16: 37,028,526 (GRCm39) D512E probably damaging Het
Tas1r2 A G 4: 139,397,046 (GRCm39) E795G probably damaging Het
Tdrd1 T A 19: 56,831,145 (GRCm39) V320D probably damaging Het
Tmem71 T A 15: 66,404,606 (GRCm39) I261L probably benign Het
Tns2 T C 15: 102,020,039 (GRCm39) L643P probably damaging Het
Usp43 A T 11: 67,782,307 (GRCm39) H370Q possibly damaging Het
Vmn1r236 T A 17: 21,507,356 (GRCm39) I158N possibly damaging Het
Vmn2r98 T A 17: 19,286,532 (GRCm39) N343K probably benign Het
Vwa8 T C 14: 79,329,815 (GRCm39) S1216P probably benign Het
Yars1 A C 4: 129,090,747 (GRCm39) D97A probably damaging Het
Zer1 G A 2: 30,001,035 (GRCm39) H129Y probably benign Het
Zfat C T 15: 67,956,404 (GRCm39) D1143N possibly damaging Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2143:Upf1 UTSW 8 70,792,004 (GRCm39) missense probably null 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4838:Upf1 UTSW 8 70,792,018 (GRCm39) missense probably benign 0.03
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7205:Upf1 UTSW 8 70,792,695 (GRCm39) missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70,793,268 (GRCm39) missense probably damaging 1.00
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8079:Upf1 UTSW 8 70,791,534 (GRCm39) critical splice donor site probably null
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8544:Upf1 UTSW 8 70,789,702 (GRCm39) missense probably damaging 1.00
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAATGTGTCAGTCAACAGC -3'
(R):5'- TAGAGAGCTGCGAATCACAC -3'

Sequencing Primer
(F):5'- TGTGTCAGTCAACAGCAGCAG -3'
(R):5'- AGAGCTCTCACTGCTGCTTAAGTG -3'
Posted On 2021-08-31