Incidental Mutation 'R8906:Vmn2r98'
ID 680150
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R8906 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19066270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 343 (N343K)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: N343K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: N343K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A C 19: 3,716,686 N91T possibly damaging Het
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
4932414N04Rik A G 2: 68,732,154 D375G possibly damaging Het
4932415D10Rik T C 10: 82,286,545 T3544A probably benign Het
Adad2 C A 8: 119,612,986 P69Q probably benign Het
Adamts3 G A 5: 89,677,716 T1088I probably damaging Het
Ank2 A G 3: 126,933,071 V858A probably benign Het
Ankrd13a A G 5: 114,801,737 N475S probably benign Het
Barhl2 G A 5: 106,455,486 T269I probably benign Het
Boc G A 16: 44,503,568 R157W Het
Bsn G T 9: 108,107,553 P3101T unknown Het
Catsperb C A 12: 101,520,645 A477E possibly damaging Het
Ccser1 T A 6: 61,810,858 I220K probably benign Het
Cd200r3 A T 16: 44,957,739 I242F possibly damaging Het
Cdc34b A C 11: 94,742,085 D37A probably damaging Het
Chek2 A G 5: 110,865,592 probably benign Het
Cngb1 A T 8: 95,263,108 V792D probably damaging Het
Cops7a T C 6: 124,962,408 K93E possibly damaging Het
Crispld1 T C 1: 17,750,771 I345T possibly damaging Het
Dgkd A G 1: 87,941,435 D1170G probably damaging Het
Dhx35 A G 2: 158,806,998 T115A possibly damaging Het
Dnaic1 G A 4: 41,625,125 R363H probably benign Het
Dnmbp T A 19: 43,890,242 Q130L probably benign Het
Egfr A G 11: 16,911,635 Y1138C probably damaging Het
Elf3 A T 1: 135,254,940 L329Q probably damaging Het
Enkur A G 2: 21,196,757 M39T probably benign Het
Epha7 T C 4: 28,821,615 I260T probably damaging Het
Fbxo28 A T 1: 182,317,069 I310K probably damaging Het
Fga C A 3: 83,031,804 N495K probably benign Het
Galnt6 T C 15: 100,703,366 D344G probably damaging Het
Gm572 A G 4: 148,666,833 Q221R probably benign Het
Gm6205 G T 5: 94,683,554 R140L possibly damaging Het
Gpa33 G A 1: 166,146,647 A18T probably benign Het
Gpatch11 C T 17: 78,837,860 T6I probably benign Het
Gpr84 T A 15: 103,309,198 S151C probably damaging Het
H2-M11 T A 17: 36,548,959 Y281* probably null Het
Hadh T C 3: 131,245,242 N155S probably benign Het
Hoxd13 A G 2: 74,669,922 Y269C Het
Iars T A 13: 49,728,701 C1074S probably benign Het
Ibtk G T 9: 85,743,404 H98N possibly damaging Het
Igsf10 C T 3: 59,326,318 G1665R probably benign Het
Inpp5d A G 1: 87,697,615 probably benign Het
Ipo9 A C 1: 135,394,213 V593G probably damaging Het
Irx3 T C 8: 91,800,287 D263G possibly damaging Het
Kif13a A G 13: 46,773,678 V1179A probably benign Het
Lrrc4c T C 2: 97,630,048 Y340H probably benign Het
Lysmd1 A G 3: 95,137,908 D155G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Mob2 A T 7: 142,009,524 L66Q probably damaging Het
Myh1 A G 11: 67,205,913 S337G probably benign Het
Neb T C 2: 52,206,247 D1002G probably benign Het
Nebl A T 2: 17,378,117 N116K probably benign Het
Nkx2-6 T C 14: 69,175,174 S264P probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4e A G 7: 23,321,131 T348A possibly damaging Het
Nomo1 A T 7: 46,072,580 I982F probably benign Het
Olfr16 A G 1: 172,956,619 probably benign Het
Olfr348 A T 2: 36,786,609 Y28F probably benign Het
Olfr739 T G 14: 50,424,834 F105C probably damaging Het
Olfr936 A G 9: 39,046,781 F213L possibly damaging Het
Palld A G 8: 61,550,164 probably null Het
Pcdh7 A G 5: 57,721,812 Y903C probably damaging Het
Pknox2 G A 9: 36,892,871 T460M possibly damaging Het
Ppm1h C T 10: 122,878,546 T330I probably damaging Het
Ppp2r2b C T 18: 42,688,334 R253H probably damaging Het
Prr18 G A 17: 8,341,644 A211T probably benign Het
Ptgs2 A G 1: 150,104,108 I321M Het
Rara G T 11: 98,970,163 R159L probably damaging Het
Rasa4 T A 5: 136,104,592 I635N probably benign Het
Rxfp2 A T 5: 150,066,423 H423L possibly damaging Het
Scn4b A G 9: 45,147,871 I147V possibly damaging Het
Scrn3 G A 2: 73,331,008 V313I probably benign Het
Scrn3 C A 2: 73,331,011 P314T possibly damaging Het
Sh2b1 A G 7: 126,471,120 probably null Het
Slc26a10 T C 10: 127,180,590 Q3R probably benign Het
Slitrk1 A G 14: 108,911,707 I524T probably damaging Het
Smcp T A 3: 92,584,223 N106Y unknown Het
St8sia5 G A 18: 77,248,476 V202M probably damaging Het
Stxbp5l A T 16: 37,208,164 D512E probably damaging Het
Tas1r2 A G 4: 139,669,735 E795G probably damaging Het
Tdrd1 T A 19: 56,842,713 V320D probably damaging Het
Tmem71 T A 15: 66,532,757 I261L probably benign Het
Tns2 T C 15: 102,111,604 L643P probably damaging Het
Upf1 G A 8: 70,334,165 Q890* probably null Het
Usp43 A T 11: 67,891,481 H370Q possibly damaging Het
Vmn1r236 T A 17: 21,287,094 I158N possibly damaging Het
Vwa8 T C 14: 79,092,375 S1216P probably benign Het
Yars A C 4: 129,196,954 D97A probably damaging Het
Zer1 G A 2: 30,111,023 H129Y probably benign Het
Zfat C T 15: 68,084,555 D1143N possibly damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGACATTGATTCACTAGAAGG -3'
(R):5'- TGCATTTGAAGTTGCTGAAGTC -3'

Sequencing Primer
(F):5'- GAGCAAAGGTTATTGACATGG -3'
(R):5'- CTGAAGTCTCATCTCATGGAGGC -3'
Posted On 2021-08-31