Incidental Mutation 'R8925:Nedd1'
ID 680198
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Name neural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R8925 (G1)
Quality Score 169.009
Status Validated
Chromosome 10
Chromosomal Location 92684746-92722420 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to A at 92722396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163] [ENSMUST00000216086]
AlphaFold P33215
Predicted Effect probably benign
Transcript: ENSMUST00000020163
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,258,522 R190* probably null Het
4930402H24Rik T A 2: 130,737,380 R777* probably null Het
Aldh7a1 A T 18: 56,526,988 S529T probably benign Het
Als2cr12 A T 1: 58,667,723 probably null Het
Carmil2 T G 8: 105,688,498 Y214* probably null Het
Ccdc105 T C 10: 78,752,424 Y184C probably damaging Het
Ccdc136 A G 6: 29,406,110 I152V probably damaging Het
Ccdc88c T C 12: 100,966,417 D285G possibly damaging Het
Clec4a3 T A 6: 122,969,369 F191I probably damaging Het
Dlg5 A T 14: 24,156,479 S1222T Het
Dnah14 T G 1: 181,680,756 L1833W probably damaging Het
Dsg2 T C 18: 20,592,478 W549R probably damaging Het
Ezh2 A T 6: 47,533,779 V632E possibly damaging Het
Fam83a G A 15: 58,009,917 V381M probably benign Het
Fmo2 T C 1: 162,876,829 T503A probably benign Het
Foxo1 T C 3: 52,345,282 F289L probably damaging Het
Gckr A G 5: 31,299,559 E96G probably damaging Het
Gm18596 G A 10: 77,742,328 A104V unknown Het
Gm21680 A T 5: 25,971,349 N83K probably damaging Het
Gnb5 T C 9: 75,344,954 V393A possibly damaging Het
Grin2b T G 6: 135,772,341 Q621P probably damaging Het
Gtsf2 T C 15: 103,444,356 I79V probably benign Het
Itga1 T C 13: 114,968,519 I1040V probably benign Het
Kif2b C T 11: 91,577,197 E87K probably benign Het
Klk1b8 G A 7: 43,954,782 G225S probably damaging Het
L3mbtl3 A T 10: 26,344,186 C94S unknown Het
Man2c1 T G 9: 57,141,172 Y872* probably null Het
Mical3 T A 6: 121,007,364 M832L probably benign Het
Mrc2 A G 11: 105,325,508 D41G probably benign Het
Nefh TTTGGCCTCAGCTGGTGACTTGGGCTCAGCTGGAGACTTGGCCTCACCTGGTGACTTG TTTGGCCTCACCTGGTGACTTG 11: 4,940,530 probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Notch3 C T 17: 32,153,818 R593Q probably benign Het
Nxpe3 T G 16: 55,849,634 E369D possibly damaging Het
Obscn T A 11: 59,086,869 T1802S possibly damaging Het
Olfr13 T C 6: 43,174,735 F250L probably benign Het
Olfr1301 A T 2: 111,754,762 H171L probably benign Het
Olfr1410 A G 1: 92,608,716 N293S probably damaging Het
Olfr393 A T 11: 73,847,580 F182I probably benign Het
Oscar A C 7: 3,611,748 V75G probably benign Het
Pcdhb17 G A 18: 37,487,319 A721T probably benign Het
Pcnx2 T C 8: 125,887,920 Y264C probably benign Het
Pear1 G T 3: 87,754,583 A495D probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhf1 C A 7: 38,221,574 R190L probably damaging Het
Plppr5 T C 3: 117,575,883 V63A probably benign Het
Pyroxd1 T A 6: 142,354,711 F189Y probably damaging Het
Rab13 C T 3: 90,220,813 probably benign Het
Rptor C T 11: 119,891,210 T1121I probably benign Het
Scgb2b7 T C 7: 31,705,177 S33G probably benign Het
Slc25a36 A G 9: 97,100,073 probably null Het
Smc1b A T 15: 85,107,072 probably null Het
Smtn T A 11: 3,529,477 H530L possibly damaging Het
Srrt C T 5: 137,298,808 C411Y probably benign Het
Stag1 C A 9: 100,705,245 P7Q possibly damaging Het
Tarm1 G A 7: 3,489,203 T248I possibly damaging Het
Trim6 C T 7: 104,232,448 A328V probably benign Het
Vmn1r189 T C 13: 22,102,641 I9V probably benign Het
Vmn2r93 A G 17: 18,326,238 T791A probably damaging Het
Vsig10l A G 7: 43,466,596 T454A probably benign Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
Brainless UTSW 10 92690773 missense probably benign 0.01
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0645:Nedd1 UTSW 10 92691831 splice site probably null
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92719603 missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92694998 missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92695031 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92686240 missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
R7406:Nedd1 UTSW 10 92711323 splice site probably null
R7455:Nedd1 UTSW 10 92700925 missense probably benign 0.01
R7587:Nedd1 UTSW 10 92698730 missense probably benign 0.01
R7745:Nedd1 UTSW 10 92714172 missense probably benign
R8104:Nedd1 UTSW 10 92691916 missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92691935 missense probably benign
R8226:Nedd1 UTSW 10 92691935 missense probably benign
R8927:Nedd1 UTSW 10 92722396 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTGGCCCTTAAATCCGG -3'
(R):5'- AGAGTTGCCCGTGAATTCCC -3'

Sequencing Primer
(F):5'- TTAAATCCGGGGCCCGC -3'
(R):5'- TGGCTTAGAACTCAGCAGTC -3'
Posted On 2021-08-31