Incidental Mutation 'R8930:Kdm5b'
ID 680221
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 068774-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R8930 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 134544010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 853 (P853L)
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
Predicted Effect probably damaging
Transcript: ENSMUST00000047714
AA Change: P853L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: P853L

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112198
AA Change: P853L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: P853L

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Meta Mutation Damage Score 0.7157 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,629,693 (GRCm39) probably null Het
Abl2 A G 1: 156,461,402 (GRCm39) T435A probably damaging Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Ankrd11 C T 8: 123,622,718 (GRCm39) R378K probably damaging Het
Arap1 G A 7: 101,057,324 (GRCm39) R1355Q possibly damaging Het
Ass1 T A 2: 31,382,387 (GRCm39) M186K probably damaging Het
Bckdk A G 7: 127,507,182 (GRCm39) D312G probably benign Het
Btg3 T A 16: 78,170,298 (GRCm39) N3I probably benign Het
Cd163 T C 6: 124,294,882 (GRCm39) F649L probably damaging Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cnksr3 A T 10: 7,110,780 (GRCm39) V27E probably damaging Het
Col12a1 A T 9: 79,580,665 (GRCm39) S1512T probably benign Het
Cstf1 A G 2: 172,217,623 (GRCm39) T79A probably benign Het
Defa24 T C 8: 22,225,373 (GRCm39) Y88H probably benign Het
Dgkz C T 2: 91,769,915 (GRCm39) R389Q probably damaging Het
Dsg3 T A 18: 20,672,718 (GRCm39) D796E probably damaging Het
Dyrk3 G T 1: 131,057,293 (GRCm39) D293E probably damaging Het
Epb42 T C 2: 120,854,767 (GRCm39) D606G probably benign Het
Erich5 G A 15: 34,453,844 (GRCm39) G18S probably benign Het
Fam8a1 C T 13: 46,827,868 (GRCm39) T352M probably benign Het
Fastkd3 T A 13: 68,731,835 (GRCm39) L52Q probably benign Het
Fat3 G A 9: 15,910,819 (GRCm39) H1728Y probably benign Het
Fgl1 A G 8: 41,662,868 (GRCm39) V39A probably benign Het
Gm7298 T C 6: 121,742,030 (GRCm39) V484A probably benign Het
Gpr75 A G 11: 30,842,571 (GRCm39) Q492R possibly damaging Het
Hoxc8 A G 15: 102,899,318 (GRCm39) H36R possibly damaging Het
Insyn2a A G 7: 134,500,881 (GRCm39) I408T probably damaging Het
Insyn2b T C 11: 34,352,707 (GRCm39) S250P probably benign Het
Isy1 T C 6: 87,798,513 (GRCm39) I214V probably damaging Het
Man2b1 A G 8: 85,822,022 (GRCm39) T746A probably damaging Het
Mast3 A T 8: 71,234,377 (GRCm39) probably benign Het
Mki67 A G 7: 135,300,628 (GRCm39) S1469P possibly damaging Het
Mrps30 C T 13: 118,523,695 (GRCm39) A26T probably benign Het
Mup10 T A 4: 60,536,708 (GRCm39) T92S possibly damaging Het
Otud7a A G 7: 63,407,239 (GRCm39) D514G possibly damaging Het
Pacs1 T A 19: 5,185,030 (GRCm39) S932C probably damaging Het
Pbx2 C T 17: 34,813,563 (GRCm39) R188C probably damaging Het
Pclo C T 5: 14,762,989 (GRCm39) P536S possibly damaging Het
Pdxdc1 A T 16: 13,672,269 (GRCm39) I377N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phip T C 9: 82,789,041 (GRCm39) K758E possibly damaging Het
Pramel34 T G 5: 93,785,944 (GRCm39) D112A probably benign Het
Ptprm C T 17: 67,263,846 (GRCm39) R467H probably benign Het
Scnn1b C T 7: 121,502,067 (GRCm39) R242C probably damaging Het
Seh1l T C 18: 67,908,134 (GRCm39) S19P possibly damaging Het
Slc28a1 T A 7: 80,817,715 (GRCm39) V528D probably benign Het
Slc6a17 G T 3: 107,379,507 (GRCm39) Q554K probably benign Het
Spag16 G A 1: 70,338,928 (GRCm39) probably null Het
Spata31d1e C T 13: 59,890,015 (GRCm39) E184K possibly damaging Het
Srfbp1 T A 18: 52,623,117 (GRCm39) N377K possibly damaging Het
Stap2 A G 17: 56,304,895 (GRCm39) S296P probably benign Het
Tnr A T 1: 159,740,359 (GRCm39) I1178F probably damaging Het
Tomt C T 7: 101,550,350 (GRCm39) A139T probably damaging Het
Trak2 T C 1: 58,974,967 (GRCm39) Q75R probably benign Het
Tulp1 T C 17: 28,583,468 (GRCm39) K58E probably benign Het
Utp6 A G 11: 79,834,055 (GRCm39) probably null Het
Vmn1r21 T C 6: 57,820,998 (GRCm39) T149A probably benign Het
Vmn1r238 C T 18: 3,123,127 (GRCm39) V96M probably benign Het
Vmn1r9 T A 6: 57,048,666 (GRCm39) I247N probably damaging Het
Vps33b T C 7: 79,932,241 (GRCm39) C138R possibly damaging Het
Wnk1 A T 6: 119,940,226 (GRCm39) V837E probably damaging Het
Xirp2 C T 2: 67,312,707 (GRCm39) H59Y possibly damaging Het
Zbtb38 G T 9: 96,568,434 (GRCm39) D883E probably benign Het
Zbtb7a C A 10: 80,980,368 (GRCm39) D187E probably benign Het
Zfp511 T C 7: 139,617,442 (GRCm39) V148A probably damaging Het
Zfp52 A G 17: 21,780,692 (GRCm39) D180G possibly damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCACCTGAACCTAGGAAC -3'
(R):5'- GAGCTCAGAACCATCTCTCC -3'

Sequencing Primer
(F):5'- ACCCATTGGCATCTCCGAGTAATG -3'
(R):5'- GACTTACTATGGAGCCCAGACTG -3'
Posted On 2021-08-31