Incidental Mutation 'R8930:Cd163'
ID 680240
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene Name CD163 antigen
Synonyms
MMRRC Submission 068774-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8930 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124281615-124307486 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124294882 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 649 (F649L)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
AlphaFold Q2VLH6
Predicted Effect probably damaging
Transcript: ENSMUST00000032234
AA Change: F649L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: F649L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112541
AA Change: F649L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: F649L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,629,693 (GRCm39) probably null Het
Abl2 A G 1: 156,461,402 (GRCm39) T435A probably damaging Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Ankrd11 C T 8: 123,622,718 (GRCm39) R378K probably damaging Het
Arap1 G A 7: 101,057,324 (GRCm39) R1355Q possibly damaging Het
Ass1 T A 2: 31,382,387 (GRCm39) M186K probably damaging Het
Bckdk A G 7: 127,507,182 (GRCm39) D312G probably benign Het
Btg3 T A 16: 78,170,298 (GRCm39) N3I probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cnksr3 A T 10: 7,110,780 (GRCm39) V27E probably damaging Het
Col12a1 A T 9: 79,580,665 (GRCm39) S1512T probably benign Het
Cstf1 A G 2: 172,217,623 (GRCm39) T79A probably benign Het
Defa24 T C 8: 22,225,373 (GRCm39) Y88H probably benign Het
Dgkz C T 2: 91,769,915 (GRCm39) R389Q probably damaging Het
Dsg3 T A 18: 20,672,718 (GRCm39) D796E probably damaging Het
Dyrk3 G T 1: 131,057,293 (GRCm39) D293E probably damaging Het
Epb42 T C 2: 120,854,767 (GRCm39) D606G probably benign Het
Erich5 G A 15: 34,453,844 (GRCm39) G18S probably benign Het
Fam8a1 C T 13: 46,827,868 (GRCm39) T352M probably benign Het
Fastkd3 T A 13: 68,731,835 (GRCm39) L52Q probably benign Het
Fat3 G A 9: 15,910,819 (GRCm39) H1728Y probably benign Het
Fgl1 A G 8: 41,662,868 (GRCm39) V39A probably benign Het
Gm7298 T C 6: 121,742,030 (GRCm39) V484A probably benign Het
Gpr75 A G 11: 30,842,571 (GRCm39) Q492R possibly damaging Het
Hoxc8 A G 15: 102,899,318 (GRCm39) H36R possibly damaging Het
Insyn2a A G 7: 134,500,881 (GRCm39) I408T probably damaging Het
Insyn2b T C 11: 34,352,707 (GRCm39) S250P probably benign Het
Isy1 T C 6: 87,798,513 (GRCm39) I214V probably damaging Het
Kdm5b C T 1: 134,544,010 (GRCm39) P853L probably damaging Het
Man2b1 A G 8: 85,822,022 (GRCm39) T746A probably damaging Het
Mast3 A T 8: 71,234,377 (GRCm39) probably benign Het
Mki67 A G 7: 135,300,628 (GRCm39) S1469P possibly damaging Het
Mrps30 C T 13: 118,523,695 (GRCm39) A26T probably benign Het
Mup10 T A 4: 60,536,708 (GRCm39) T92S possibly damaging Het
Otud7a A G 7: 63,407,239 (GRCm39) D514G possibly damaging Het
Pacs1 T A 19: 5,185,030 (GRCm39) S932C probably damaging Het
Pbx2 C T 17: 34,813,563 (GRCm39) R188C probably damaging Het
Pclo C T 5: 14,762,989 (GRCm39) P536S possibly damaging Het
Pdxdc1 A T 16: 13,672,269 (GRCm39) I377N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phip T C 9: 82,789,041 (GRCm39) K758E possibly damaging Het
Pramel34 T G 5: 93,785,944 (GRCm39) D112A probably benign Het
Ptprm C T 17: 67,263,846 (GRCm39) R467H probably benign Het
Scnn1b C T 7: 121,502,067 (GRCm39) R242C probably damaging Het
Seh1l T C 18: 67,908,134 (GRCm39) S19P possibly damaging Het
Slc28a1 T A 7: 80,817,715 (GRCm39) V528D probably benign Het
Slc6a17 G T 3: 107,379,507 (GRCm39) Q554K probably benign Het
Spag16 G A 1: 70,338,928 (GRCm39) probably null Het
Spata31d1e C T 13: 59,890,015 (GRCm39) E184K possibly damaging Het
Srfbp1 T A 18: 52,623,117 (GRCm39) N377K possibly damaging Het
Stap2 A G 17: 56,304,895 (GRCm39) S296P probably benign Het
Tnr A T 1: 159,740,359 (GRCm39) I1178F probably damaging Het
Tomt C T 7: 101,550,350 (GRCm39) A139T probably damaging Het
Trak2 T C 1: 58,974,967 (GRCm39) Q75R probably benign Het
Tulp1 T C 17: 28,583,468 (GRCm39) K58E probably benign Het
Utp6 A G 11: 79,834,055 (GRCm39) probably null Het
Vmn1r21 T C 6: 57,820,998 (GRCm39) T149A probably benign Het
Vmn1r238 C T 18: 3,123,127 (GRCm39) V96M probably benign Het
Vmn1r9 T A 6: 57,048,666 (GRCm39) I247N probably damaging Het
Vps33b T C 7: 79,932,241 (GRCm39) C138R possibly damaging Het
Wnk1 A T 6: 119,940,226 (GRCm39) V837E probably damaging Het
Xirp2 C T 2: 67,312,707 (GRCm39) H59Y possibly damaging Het
Zbtb38 G T 9: 96,568,434 (GRCm39) D883E probably benign Het
Zbtb7a C A 10: 80,980,368 (GRCm39) D187E probably benign Het
Zfp511 T C 7: 139,617,442 (GRCm39) V148A probably damaging Het
Zfp52 A G 17: 21,780,692 (GRCm39) D180G possibly damaging Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124,306,060 (GRCm39) splice site probably benign
IGL00755:Cd163 APN 6 124,295,616 (GRCm39) missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124,284,277 (GRCm39) missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124,284,246 (GRCm39) nonsense probably null
IGL02733:Cd163 APN 6 124,302,300 (GRCm39) missense probably damaging 1.00
IGL02801:Cd163 APN 6 124,297,488 (GRCm39) missense probably benign 0.00
IGL02897:Cd163 APN 6 124,302,486 (GRCm39) missense probably damaging 1.00
IGL03074:Cd163 APN 6 124,294,945 (GRCm39) missense probably benign 0.00
IGL03283:Cd163 APN 6 124,286,158 (GRCm39) missense possibly damaging 0.49
compass UTSW 6 124,306,045 (GRCm39) makesense probably null
hottish UTSW 6 124,286,167 (GRCm39) missense probably damaging 1.00
protractor UTSW 6 124,288,525 (GRCm39) missense probably damaging 1.00
t-square UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R0494:Cd163 UTSW 6 124,288,408 (GRCm39) missense probably damaging 1.00
R0554:Cd163 UTSW 6 124,289,619 (GRCm39) missense probably benign 0.03
R0622:Cd163 UTSW 6 124,294,311 (GRCm39) missense probably damaging 1.00
R1004:Cd163 UTSW 6 124,302,306 (GRCm39) missense probably damaging 1.00
R1061:Cd163 UTSW 6 124,286,128 (GRCm39) missense probably benign 0.00
R1132:Cd163 UTSW 6 124,286,055 (GRCm39) nonsense probably null
R1195:Cd163 UTSW 6 124,302,209 (GRCm39) splice site probably benign
R1195:Cd163 UTSW 6 124,302,209 (GRCm39) splice site probably benign
R1436:Cd163 UTSW 6 124,304,890 (GRCm39) missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124,288,406 (GRCm39) missense probably damaging 1.00
R1532:Cd163 UTSW 6 124,289,689 (GRCm39) missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124,304,920 (GRCm39) missense probably benign
R1654:Cd163 UTSW 6 124,294,540 (GRCm39) missense probably damaging 1.00
R1717:Cd163 UTSW 6 124,306,547 (GRCm39) utr 3 prime probably benign
R1744:Cd163 UTSW 6 124,283,987 (GRCm39) missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124,302,457 (GRCm39) missense probably damaging 0.99
R2035:Cd163 UTSW 6 124,297,588 (GRCm39) missense probably damaging 0.97
R2095:Cd163 UTSW 6 124,294,781 (GRCm39) missense probably damaging 1.00
R2124:Cd163 UTSW 6 124,295,815 (GRCm39) missense probably damaging 1.00
R2146:Cd163 UTSW 6 124,286,167 (GRCm39) missense probably damaging 1.00
R2353:Cd163 UTSW 6 124,296,115 (GRCm39) nonsense probably null
R3854:Cd163 UTSW 6 124,288,525 (GRCm39) missense probably damaging 1.00
R4425:Cd163 UTSW 6 124,304,862 (GRCm39) missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124,306,045 (GRCm39) makesense probably null
R4647:Cd163 UTSW 6 124,297,580 (GRCm39) missense probably damaging 1.00
R4713:Cd163 UTSW 6 124,294,577 (GRCm39) critical splice donor site probably null
R4803:Cd163 UTSW 6 124,289,389 (GRCm39) missense probably damaging 0.99
R4996:Cd163 UTSW 6 124,296,106 (GRCm39) missense probably benign 0.00
R5022:Cd163 UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R5023:Cd163 UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R5032:Cd163 UTSW 6 124,288,628 (GRCm39) missense probably damaging 1.00
R5057:Cd163 UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R5121:Cd163 UTSW 6 124,294,948 (GRCm39) missense probably damaging 1.00
R5436:Cd163 UTSW 6 124,304,923 (GRCm39) missense probably benign
R5453:Cd163 UTSW 6 124,289,500 (GRCm39) missense probably damaging 1.00
R5723:Cd163 UTSW 6 124,296,022 (GRCm39) missense probably benign 0.00
R5929:Cd163 UTSW 6 124,303,568 (GRCm39) critical splice donor site probably null
R5943:Cd163 UTSW 6 124,306,561 (GRCm39) makesense probably null
R5964:Cd163 UTSW 6 124,303,531 (GRCm39) missense probably benign 0.01
R5966:Cd163 UTSW 6 124,297,595 (GRCm39) nonsense probably null
R6279:Cd163 UTSW 6 124,294,950 (GRCm39) nonsense probably null
R6300:Cd163 UTSW 6 124,294,950 (GRCm39) nonsense probably null
R6499:Cd163 UTSW 6 124,281,703 (GRCm39) missense probably benign 0.00
R6602:Cd163 UTSW 6 124,288,594 (GRCm39) missense probably damaging 1.00
R6708:Cd163 UTSW 6 124,286,167 (GRCm39) missense probably damaging 1.00
R6767:Cd163 UTSW 6 124,281,738 (GRCm39) missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124,294,945 (GRCm39) missense probably benign 0.00
R6993:Cd163 UTSW 6 124,294,673 (GRCm39) missense probably damaging 1.00
R7345:Cd163 UTSW 6 124,295,897 (GRCm39) missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124,288,271 (GRCm39) splice site probably null
R7552:Cd163 UTSW 6 124,284,187 (GRCm39) missense probably benign 0.08
R7829:Cd163 UTSW 6 124,281,738 (GRCm39) missense probably benign 0.04
R8354:Cd163 UTSW 6 124,305,924 (GRCm39) missense probably benign 0.43
R8454:Cd163 UTSW 6 124,305,924 (GRCm39) missense probably benign 0.43
R8530:Cd163 UTSW 6 124,295,860 (GRCm39) missense probably damaging 1.00
R8560:Cd163 UTSW 6 124,294,360 (GRCm39) missense possibly damaging 0.86
R8878:Cd163 UTSW 6 124,297,469 (GRCm39) missense probably damaging 0.99
R8932:Cd163 UTSW 6 124,294,882 (GRCm39) missense probably damaging 1.00
R9074:Cd163 UTSW 6 124,285,947 (GRCm39) nonsense probably null
R9408:Cd163 UTSW 6 124,297,497 (GRCm39) missense probably benign 0.39
R9530:Cd163 UTSW 6 124,294,491 (GRCm39) nonsense probably null
R9558:Cd163 UTSW 6 124,297,471 (GRCm39) missense probably benign 0.01
R9608:Cd163 UTSW 6 124,286,163 (GRCm39) missense possibly damaging 0.79
R9685:Cd163 UTSW 6 124,288,384 (GRCm39) missense possibly damaging 0.77
Z1177:Cd163 UTSW 6 124,294,344 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CGGATGTCTTTTCTAAATCCCGG -3'
(R):5'- CAGGCTCATCGGATTCTAAAGC -3'

Sequencing Primer
(F):5'- ACATAGATATTCGTCTGGCAGGC -3'
(R):5'- CTCATCGGATTCTAAAGCACTGTGG -3'
Posted On 2021-08-31