Incidental Mutation 'R8930:Insyn2b'
ID 680264
Institutional Source Beutler Lab
Gene Symbol Insyn2b
Ensembl Gene ENSMUSG00000069911
Gene Name inhibitory synaptic factor family member 2B
Synonyms Fam196b, Gm6041
MMRRC Submission 068774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8930 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 34264822-34372642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34352707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 250 (S250P)
Ref Sequence ENSEMBL: ENSMUSP00000129183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000165963]
AlphaFold Q6GQV1
Predicted Effect probably benign
Transcript: ENSMUST00000093192
AA Change: S250P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911
AA Change: S250P

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101364
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165963
AA Change: S250P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911
AA Change: S250P

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,629,693 (GRCm39) probably null Het
Abl2 A G 1: 156,461,402 (GRCm39) T435A probably damaging Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Ankrd11 C T 8: 123,622,718 (GRCm39) R378K probably damaging Het
Arap1 G A 7: 101,057,324 (GRCm39) R1355Q possibly damaging Het
Ass1 T A 2: 31,382,387 (GRCm39) M186K probably damaging Het
Bckdk A G 7: 127,507,182 (GRCm39) D312G probably benign Het
Btg3 T A 16: 78,170,298 (GRCm39) N3I probably benign Het
Cd163 T C 6: 124,294,882 (GRCm39) F649L probably damaging Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cnksr3 A T 10: 7,110,780 (GRCm39) V27E probably damaging Het
Col12a1 A T 9: 79,580,665 (GRCm39) S1512T probably benign Het
Cstf1 A G 2: 172,217,623 (GRCm39) T79A probably benign Het
Defa24 T C 8: 22,225,373 (GRCm39) Y88H probably benign Het
Dgkz C T 2: 91,769,915 (GRCm39) R389Q probably damaging Het
Dsg3 T A 18: 20,672,718 (GRCm39) D796E probably damaging Het
Dyrk3 G T 1: 131,057,293 (GRCm39) D293E probably damaging Het
Epb42 T C 2: 120,854,767 (GRCm39) D606G probably benign Het
Erich5 G A 15: 34,453,844 (GRCm39) G18S probably benign Het
Fam8a1 C T 13: 46,827,868 (GRCm39) T352M probably benign Het
Fastkd3 T A 13: 68,731,835 (GRCm39) L52Q probably benign Het
Fat3 G A 9: 15,910,819 (GRCm39) H1728Y probably benign Het
Fgl1 A G 8: 41,662,868 (GRCm39) V39A probably benign Het
Gm7298 T C 6: 121,742,030 (GRCm39) V484A probably benign Het
Gpr75 A G 11: 30,842,571 (GRCm39) Q492R possibly damaging Het
Hoxc8 A G 15: 102,899,318 (GRCm39) H36R possibly damaging Het
Insyn2a A G 7: 134,500,881 (GRCm39) I408T probably damaging Het
Isy1 T C 6: 87,798,513 (GRCm39) I214V probably damaging Het
Kdm5b C T 1: 134,544,010 (GRCm39) P853L probably damaging Het
Man2b1 A G 8: 85,822,022 (GRCm39) T746A probably damaging Het
Mast3 A T 8: 71,234,377 (GRCm39) probably benign Het
Mki67 A G 7: 135,300,628 (GRCm39) S1469P possibly damaging Het
Mrps30 C T 13: 118,523,695 (GRCm39) A26T probably benign Het
Mup10 T A 4: 60,536,708 (GRCm39) T92S possibly damaging Het
Otud7a A G 7: 63,407,239 (GRCm39) D514G possibly damaging Het
Pacs1 T A 19: 5,185,030 (GRCm39) S932C probably damaging Het
Pbx2 C T 17: 34,813,563 (GRCm39) R188C probably damaging Het
Pclo C T 5: 14,762,989 (GRCm39) P536S possibly damaging Het
Pdxdc1 A T 16: 13,672,269 (GRCm39) I377N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phip T C 9: 82,789,041 (GRCm39) K758E possibly damaging Het
Pramel34 T G 5: 93,785,944 (GRCm39) D112A probably benign Het
Ptprm C T 17: 67,263,846 (GRCm39) R467H probably benign Het
Scnn1b C T 7: 121,502,067 (GRCm39) R242C probably damaging Het
Seh1l T C 18: 67,908,134 (GRCm39) S19P possibly damaging Het
Slc28a1 T A 7: 80,817,715 (GRCm39) V528D probably benign Het
Slc6a17 G T 3: 107,379,507 (GRCm39) Q554K probably benign Het
Spag16 G A 1: 70,338,928 (GRCm39) probably null Het
Spata31d1e C T 13: 59,890,015 (GRCm39) E184K possibly damaging Het
Srfbp1 T A 18: 52,623,117 (GRCm39) N377K possibly damaging Het
Stap2 A G 17: 56,304,895 (GRCm39) S296P probably benign Het
Tnr A T 1: 159,740,359 (GRCm39) I1178F probably damaging Het
Tomt C T 7: 101,550,350 (GRCm39) A139T probably damaging Het
Trak2 T C 1: 58,974,967 (GRCm39) Q75R probably benign Het
Tulp1 T C 17: 28,583,468 (GRCm39) K58E probably benign Het
Utp6 A G 11: 79,834,055 (GRCm39) probably null Het
Vmn1r21 T C 6: 57,820,998 (GRCm39) T149A probably benign Het
Vmn1r238 C T 18: 3,123,127 (GRCm39) V96M probably benign Het
Vmn1r9 T A 6: 57,048,666 (GRCm39) I247N probably damaging Het
Vps33b T C 7: 79,932,241 (GRCm39) C138R possibly damaging Het
Wnk1 A T 6: 119,940,226 (GRCm39) V837E probably damaging Het
Xirp2 C T 2: 67,312,707 (GRCm39) H59Y possibly damaging Het
Zbtb38 G T 9: 96,568,434 (GRCm39) D883E probably benign Het
Zbtb7a C A 10: 80,980,368 (GRCm39) D187E probably benign Het
Zfp511 T C 7: 139,617,442 (GRCm39) V148A probably damaging Het
Zfp52 A G 17: 21,780,692 (GRCm39) D180G possibly damaging Het
Other mutations in Insyn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Insyn2b APN 11 34,353,011 (GRCm39) missense probably benign
IGL01867:Insyn2b APN 11 34,353,065 (GRCm39) missense probably benign 0.39
PIT4677001:Insyn2b UTSW 11 34,353,122 (GRCm39) missense probably benign
R0317:Insyn2b UTSW 11 34,352,826 (GRCm39) missense possibly damaging 0.94
R1165:Insyn2b UTSW 11 34,352,740 (GRCm39) missense probably benign
R1710:Insyn2b UTSW 11 34,354,263 (GRCm39) splice site probably null
R2083:Insyn2b UTSW 11 34,352,141 (GRCm39) missense probably benign 0.01
R2096:Insyn2b UTSW 11 34,352,936 (GRCm39) missense probably benign 0.03
R3820:Insyn2b UTSW 11 34,353,007 (GRCm39) missense probably benign 0.01
R3821:Insyn2b UTSW 11 34,353,007 (GRCm39) missense probably benign 0.01
R3822:Insyn2b UTSW 11 34,353,007 (GRCm39) missense probably benign 0.01
R3969:Insyn2b UTSW 11 34,369,739 (GRCm39) missense probably damaging 0.99
R3970:Insyn2b UTSW 11 34,369,739 (GRCm39) missense probably damaging 0.99
R3980:Insyn2b UTSW 11 34,352,678 (GRCm39) missense probably benign 0.00
R4092:Insyn2b UTSW 11 34,351,935 (GRCm39) start gained probably benign
R4231:Insyn2b UTSW 11 34,353,143 (GRCm39) missense probably benign 0.01
R4678:Insyn2b UTSW 11 34,353,227 (GRCm39) missense probably damaging 1.00
R4859:Insyn2b UTSW 11 34,353,154 (GRCm39) missense probably benign 0.31
R4938:Insyn2b UTSW 11 34,352,231 (GRCm39) missense probably damaging 0.98
R5269:Insyn2b UTSW 11 34,352,788 (GRCm39) missense probably damaging 1.00
R5287:Insyn2b UTSW 11 34,353,058 (GRCm39) missense probably benign 0.12
R5358:Insyn2b UTSW 11 34,352,788 (GRCm39) missense probably damaging 1.00
R5359:Insyn2b UTSW 11 34,352,788 (GRCm39) missense probably damaging 1.00
R5361:Insyn2b UTSW 11 34,352,788 (GRCm39) missense probably damaging 1.00
R5362:Insyn2b UTSW 11 34,352,788 (GRCm39) missense probably damaging 1.00
R5363:Insyn2b UTSW 11 34,352,788 (GRCm39) missense probably damaging 1.00
R5403:Insyn2b UTSW 11 34,353,058 (GRCm39) missense probably benign 0.12
R5705:Insyn2b UTSW 11 34,354,349 (GRCm39) missense probably damaging 1.00
R6282:Insyn2b UTSW 11 34,352,819 (GRCm39) missense possibly damaging 0.77
R7030:Insyn2b UTSW 11 34,352,030 (GRCm39) missense probably damaging 0.96
R7069:Insyn2b UTSW 11 34,352,677 (GRCm39) missense possibly damaging 0.48
R7178:Insyn2b UTSW 11 34,352,359 (GRCm39) missense probably damaging 0.96
R7180:Insyn2b UTSW 11 34,369,873 (GRCm39) missense probably damaging 1.00
R7718:Insyn2b UTSW 11 34,352,539 (GRCm39) missense probably benign 0.00
R7789:Insyn2b UTSW 11 34,352,537 (GRCm39) missense probably benign
R7832:Insyn2b UTSW 11 34,353,034 (GRCm39) missense probably benign
R8377:Insyn2b UTSW 11 34,351,964 (GRCm39) missense probably damaging 1.00
R8932:Insyn2b UTSW 11 34,352,707 (GRCm39) missense probably benign 0.00
R9407:Insyn2b UTSW 11 34,352,072 (GRCm39) missense probably damaging 0.99
Z1177:Insyn2b UTSW 11 34,353,188 (GRCm39) missense probably damaging 1.00
Z1177:Insyn2b UTSW 11 34,352,725 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTCCTCAGAGAAAGCCACAG -3'
(R):5'- AAGATCTTCCTAGGTGGACTGG -3'

Sequencing Primer
(F):5'- GCCACAGCTGCTATTCAGG -3'
(R):5'- AGGCGAACTGTGAGTCCGTG -3'
Posted On 2021-08-31