Incidental Mutation 'R8930:Vmn1r238'
ID 680279
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Name vomeronasal 1 receptor, 238
Synonyms
MMRRC Submission 068774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8930 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 3122492-3123412 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3123127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 96 (V96M)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
AlphaFold E9Q373
Predicted Effect probably benign
Transcript: ENSMUST00000165255
AA Change: V96M

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: V96M

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,629,693 (GRCm39) probably null Het
Abl2 A G 1: 156,461,402 (GRCm39) T435A probably damaging Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Ankrd11 C T 8: 123,622,718 (GRCm39) R378K probably damaging Het
Arap1 G A 7: 101,057,324 (GRCm39) R1355Q possibly damaging Het
Ass1 T A 2: 31,382,387 (GRCm39) M186K probably damaging Het
Bckdk A G 7: 127,507,182 (GRCm39) D312G probably benign Het
Btg3 T A 16: 78,170,298 (GRCm39) N3I probably benign Het
Cd163 T C 6: 124,294,882 (GRCm39) F649L probably damaging Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cnksr3 A T 10: 7,110,780 (GRCm39) V27E probably damaging Het
Col12a1 A T 9: 79,580,665 (GRCm39) S1512T probably benign Het
Cstf1 A G 2: 172,217,623 (GRCm39) T79A probably benign Het
Defa24 T C 8: 22,225,373 (GRCm39) Y88H probably benign Het
Dgkz C T 2: 91,769,915 (GRCm39) R389Q probably damaging Het
Dsg3 T A 18: 20,672,718 (GRCm39) D796E probably damaging Het
Dyrk3 G T 1: 131,057,293 (GRCm39) D293E probably damaging Het
Epb42 T C 2: 120,854,767 (GRCm39) D606G probably benign Het
Erich5 G A 15: 34,453,844 (GRCm39) G18S probably benign Het
Fam8a1 C T 13: 46,827,868 (GRCm39) T352M probably benign Het
Fastkd3 T A 13: 68,731,835 (GRCm39) L52Q probably benign Het
Fat3 G A 9: 15,910,819 (GRCm39) H1728Y probably benign Het
Fgl1 A G 8: 41,662,868 (GRCm39) V39A probably benign Het
Gm7298 T C 6: 121,742,030 (GRCm39) V484A probably benign Het
Gpr75 A G 11: 30,842,571 (GRCm39) Q492R possibly damaging Het
Hoxc8 A G 15: 102,899,318 (GRCm39) H36R possibly damaging Het
Insyn2a A G 7: 134,500,881 (GRCm39) I408T probably damaging Het
Insyn2b T C 11: 34,352,707 (GRCm39) S250P probably benign Het
Isy1 T C 6: 87,798,513 (GRCm39) I214V probably damaging Het
Kdm5b C T 1: 134,544,010 (GRCm39) P853L probably damaging Het
Man2b1 A G 8: 85,822,022 (GRCm39) T746A probably damaging Het
Mast3 A T 8: 71,234,377 (GRCm39) probably benign Het
Mki67 A G 7: 135,300,628 (GRCm39) S1469P possibly damaging Het
Mrps30 C T 13: 118,523,695 (GRCm39) A26T probably benign Het
Mup10 T A 4: 60,536,708 (GRCm39) T92S possibly damaging Het
Otud7a A G 7: 63,407,239 (GRCm39) D514G possibly damaging Het
Pacs1 T A 19: 5,185,030 (GRCm39) S932C probably damaging Het
Pbx2 C T 17: 34,813,563 (GRCm39) R188C probably damaging Het
Pclo C T 5: 14,762,989 (GRCm39) P536S possibly damaging Het
Pdxdc1 A T 16: 13,672,269 (GRCm39) I377N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phip T C 9: 82,789,041 (GRCm39) K758E possibly damaging Het
Pramel34 T G 5: 93,785,944 (GRCm39) D112A probably benign Het
Ptprm C T 17: 67,263,846 (GRCm39) R467H probably benign Het
Scnn1b C T 7: 121,502,067 (GRCm39) R242C probably damaging Het
Seh1l T C 18: 67,908,134 (GRCm39) S19P possibly damaging Het
Slc28a1 T A 7: 80,817,715 (GRCm39) V528D probably benign Het
Slc6a17 G T 3: 107,379,507 (GRCm39) Q554K probably benign Het
Spag16 G A 1: 70,338,928 (GRCm39) probably null Het
Spata31d1e C T 13: 59,890,015 (GRCm39) E184K possibly damaging Het
Srfbp1 T A 18: 52,623,117 (GRCm39) N377K possibly damaging Het
Stap2 A G 17: 56,304,895 (GRCm39) S296P probably benign Het
Tnr A T 1: 159,740,359 (GRCm39) I1178F probably damaging Het
Tomt C T 7: 101,550,350 (GRCm39) A139T probably damaging Het
Trak2 T C 1: 58,974,967 (GRCm39) Q75R probably benign Het
Tulp1 T C 17: 28,583,468 (GRCm39) K58E probably benign Het
Utp6 A G 11: 79,834,055 (GRCm39) probably null Het
Vmn1r21 T C 6: 57,820,998 (GRCm39) T149A probably benign Het
Vmn1r9 T A 6: 57,048,666 (GRCm39) I247N probably damaging Het
Vps33b T C 7: 79,932,241 (GRCm39) C138R possibly damaging Het
Wnk1 A T 6: 119,940,226 (GRCm39) V837E probably damaging Het
Xirp2 C T 2: 67,312,707 (GRCm39) H59Y possibly damaging Het
Zbtb38 G T 9: 96,568,434 (GRCm39) D883E probably benign Het
Zbtb7a C A 10: 80,980,368 (GRCm39) D187E probably benign Het
Zfp511 T C 7: 139,617,442 (GRCm39) V148A probably damaging Het
Zfp52 A G 17: 21,780,692 (GRCm39) D180G possibly damaging Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3,123,243 (GRCm39) missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3,122,770 (GRCm39) missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3,123,124 (GRCm39) missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3,123,135 (GRCm39) missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3,123,358 (GRCm39) missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3,123,040 (GRCm39) nonsense probably null
R3024:Vmn1r238 UTSW 18 3,123,305 (GRCm39) missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3,123,214 (GRCm39) nonsense probably null
R4304:Vmn1r238 UTSW 18 3,123,040 (GRCm39) nonsense probably null
R4586:Vmn1r238 UTSW 18 3,123,294 (GRCm39) missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3,123,300 (GRCm39) missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3,123,243 (GRCm39) missense probably benign
R5430:Vmn1r238 UTSW 18 3,122,521 (GRCm39) missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3,123,168 (GRCm39) missense probably benign
R7186:Vmn1r238 UTSW 18 3,122,661 (GRCm39) missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3,122,623 (GRCm39) missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3,122,875 (GRCm39) missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3,123,151 (GRCm39) missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3,123,393 (GRCm39) missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3,122,721 (GRCm39) missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3,123,033 (GRCm39) missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3,123,151 (GRCm39) missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3,123,250 (GRCm39) missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3,122,529 (GRCm39) missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3,123,365 (GRCm39) nonsense probably null
R8747:Vmn1r238 UTSW 18 3,123,232 (GRCm39) missense possibly damaging 0.87
R8932:Vmn1r238 UTSW 18 3,123,127 (GRCm39) missense probably benign 0.03
R9279:Vmn1r238 UTSW 18 3,122,994 (GRCm39) missense probably damaging 0.99
R9382:Vmn1r238 UTSW 18 3,122,676 (GRCm39) missense probably damaging 0.99
R9644:Vmn1r238 UTSW 18 3,122,635 (GRCm39) missense probably benign 0.10
R9725:Vmn1r238 UTSW 18 3,122,577 (GRCm39) missense probably benign 0.00
Z1177:Vmn1r238 UTSW 18 3,122,505 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGATTCTCTTAGTGGAGTC -3'
(R):5'- CAGTGGGAATGTTTGGCAATTC -3'

Sequencing Primer
(F):5'- TCAAGATGTTTAGAAGCAGGTGCAC -3'
(R):5'- GGGAATGTTTGGCAATTCCTCAATC -3'
Posted On 2021-08-31