Incidental Mutation 'R8930:Vmn1r238'
ID 680279
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Name vomeronasal 1 receptor, 238
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8930 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 3122492-3123412 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3123127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 96 (V96M)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
AlphaFold E9Q373
Predicted Effect probably benign
Transcript: ENSMUST00000165255
AA Change: V96M

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: V96M

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,201 E184K possibly damaging Het
4921524L21Rik T C 18: 6,629,693 probably null Het
Abl2 A G 1: 156,633,832 T435A probably damaging Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Ankrd11 C T 8: 122,895,979 R378K probably damaging Het
Arap1 G A 7: 101,408,117 R1355Q possibly damaging Het
Ass1 T A 2: 31,492,375 M186K probably damaging Het
Bckdk A G 7: 127,908,010 D312G probably benign Het
Btg3 T A 16: 78,373,410 N3I probably benign Het
C87414 T G 5: 93,638,085 D112A probably benign Het
Cd163 T C 6: 124,317,923 F649L probably damaging Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cnksr3 A T 10: 7,160,780 V27E probably damaging Het
Col12a1 A T 9: 79,673,383 S1512T probably benign Het
Cstf1 A G 2: 172,375,703 T79A probably benign Het
Defa24 T C 8: 21,735,357 Y88H probably benign Het
Dgkz C T 2: 91,939,570 R389Q probably damaging Het
Dsg3 T A 18: 20,539,661 D796E probably damaging Het
Dyrk3 G T 1: 131,129,556 D293E probably damaging Het
Epb42 T C 2: 121,024,286 D606G probably benign Het
Erich5 G A 15: 34,453,698 G18S probably benign Het
Fam196a A G 7: 134,899,152 I408T probably damaging Het
Fam196b T C 11: 34,402,707 S250P probably benign Het
Fam8a1 C T 13: 46,674,392 T352M probably benign Het
Fastkd3 T A 13: 68,583,716 L52Q probably benign Het
Fat3 G A 9: 15,999,523 H1728Y probably benign Het
Fgl1 A G 8: 41,209,831 V39A probably benign Het
Gm7298 T C 6: 121,765,071 V484A probably benign Het
Gpr75 A G 11: 30,892,571 Q492R possibly damaging Het
Hoxc8 A G 15: 102,990,886 H36R possibly damaging Het
Isy1 T C 6: 87,821,531 I214V probably damaging Het
Kdm5b C T 1: 134,616,272 P853L probably damaging Het
Man2b1 A G 8: 85,095,393 T746A probably damaging Het
Mast3 A T 8: 70,781,733 probably benign Het
Mki67 A G 7: 135,698,899 S1469P possibly damaging Het
Mrps30 C T 13: 118,387,159 A26T probably benign Het
Mup10 T A 4: 60,580,709 T92S possibly damaging Het
Otud7a A G 7: 63,757,491 D514G possibly damaging Het
Pacs1 T A 19: 5,135,002 S932C probably damaging Het
Pbx2 C T 17: 34,594,589 R188C probably damaging Het
Pclo C T 5: 14,712,975 P536S possibly damaging Het
Pdxdc1 A T 16: 13,854,405 I377N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phip T C 9: 82,906,988 K758E possibly damaging Het
Ptprm C T 17: 66,956,851 R467H probably benign Het
Scnn1b C T 7: 121,902,844 R242C probably damaging Het
Seh1l T C 18: 67,775,064 S19P possibly damaging Het
Slc28a1 T A 7: 81,167,967 V528D probably benign Het
Slc6a17 G T 3: 107,472,191 Q554K probably benign Het
Spag16 G A 1: 70,299,769 probably null Het
Srfbp1 T A 18: 52,490,045 N377K possibly damaging Het
Stap2 A G 17: 55,997,895 S296P probably benign Het
Tnr A T 1: 159,912,789 I1178F probably damaging Het
Tomt C T 7: 101,901,143 A139T probably damaging Het
Trak2 T C 1: 58,935,808 Q75R probably benign Het
Tulp1 T C 17: 28,364,494 K58E probably benign Het
Utp6 A G 11: 79,943,229 probably null Het
Vmn1r21 T C 6: 57,844,013 T149A probably benign Het
Vmn1r9 T A 6: 57,071,681 I247N probably damaging Het
Vps33b T C 7: 80,282,493 C138R possibly damaging Het
Wnk1 A T 6: 119,963,265 V837E probably damaging Het
Xirp2 C T 2: 67,482,363 H59Y possibly damaging Het
Zbtb38 G T 9: 96,686,381 D883E probably benign Het
Zbtb7a C A 10: 81,144,534 D187E probably benign Het
Zfp511 T C 7: 140,037,529 V148A probably damaging Het
Zfp52 A G 17: 21,560,430 D180G possibly damaging Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3122529 missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3123365 nonsense probably null
R8747:Vmn1r238 UTSW 18 3123232 missense possibly damaging 0.87
R8932:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R9279:Vmn1r238 UTSW 18 3122994 missense probably damaging 0.99
R9382:Vmn1r238 UTSW 18 3122676 missense probably damaging 0.99
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGATTCTCTTAGTGGAGTC -3'
(R):5'- CAGTGGGAATGTTTGGCAATTC -3'

Sequencing Primer
(F):5'- TCAAGATGTTTAGAAGCAGGTGCAC -3'
(R):5'- GGGAATGTTTGGCAATTCCTCAATC -3'
Posted On 2021-08-31