Incidental Mutation 'R8930:Pacs1'
ID 680284
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8930 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5133688-5273119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5135002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 932 (S932C)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: S932C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: S932C

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,201 E184K possibly damaging Het
4921524L21Rik T C 18: 6,629,693 probably null Het
Abl2 A G 1: 156,633,832 T435A probably damaging Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Ankrd11 C T 8: 122,895,979 R378K probably damaging Het
Arap1 G A 7: 101,408,117 R1355Q possibly damaging Het
Ass1 T A 2: 31,492,375 M186K probably damaging Het
Bckdk A G 7: 127,908,010 D312G probably benign Het
Btg3 T A 16: 78,373,410 N3I probably benign Het
C87414 T G 5: 93,638,085 D112A probably benign Het
Cd163 T C 6: 124,317,923 F649L probably damaging Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cnksr3 A T 10: 7,160,780 V27E probably damaging Het
Col12a1 A T 9: 79,673,383 S1512T probably benign Het
Cstf1 A G 2: 172,375,703 T79A probably benign Het
Defa24 T C 8: 21,735,357 Y88H probably benign Het
Dgkz C T 2: 91,939,570 R389Q probably damaging Het
Dsg3 T A 18: 20,539,661 D796E probably damaging Het
Dyrk3 G T 1: 131,129,556 D293E probably damaging Het
Epb42 T C 2: 121,024,286 D606G probably benign Het
Erich5 G A 15: 34,453,698 G18S probably benign Het
Fam196a A G 7: 134,899,152 I408T probably damaging Het
Fam196b T C 11: 34,402,707 S250P probably benign Het
Fam8a1 C T 13: 46,674,392 T352M probably benign Het
Fastkd3 T A 13: 68,583,716 L52Q probably benign Het
Fat3 G A 9: 15,999,523 H1728Y probably benign Het
Fgl1 A G 8: 41,209,831 V39A probably benign Het
Gm7298 T C 6: 121,765,071 V484A probably benign Het
Gpr75 A G 11: 30,892,571 Q492R possibly damaging Het
Hoxc8 A G 15: 102,990,886 H36R possibly damaging Het
Isy1 T C 6: 87,821,531 I214V probably damaging Het
Kdm5b C T 1: 134,616,272 P853L probably damaging Het
Man2b1 A G 8: 85,095,393 T746A probably damaging Het
Mast3 A T 8: 70,781,733 probably benign Het
Mki67 A G 7: 135,698,899 S1469P possibly damaging Het
Mrps30 C T 13: 118,387,159 A26T probably benign Het
Mup10 T A 4: 60,580,709 T92S possibly damaging Het
Otud7a A G 7: 63,757,491 D514G possibly damaging Het
Pbx2 C T 17: 34,594,589 R188C probably damaging Het
Pclo C T 5: 14,712,975 P536S possibly damaging Het
Pdxdc1 A T 16: 13,854,405 I377N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phip T C 9: 82,906,988 K758E possibly damaging Het
Ptprm C T 17: 66,956,851 R467H probably benign Het
Scnn1b C T 7: 121,902,844 R242C probably damaging Het
Seh1l T C 18: 67,775,064 S19P possibly damaging Het
Slc28a1 T A 7: 81,167,967 V528D probably benign Het
Slc6a17 G T 3: 107,472,191 Q554K probably benign Het
Spag16 G A 1: 70,299,769 probably null Het
Srfbp1 T A 18: 52,490,045 N377K possibly damaging Het
Stap2 A G 17: 55,997,895 S296P probably benign Het
Tnr A T 1: 159,912,789 I1178F probably damaging Het
Tomt C T 7: 101,901,143 A139T probably damaging Het
Trak2 T C 1: 58,935,808 Q75R probably benign Het
Tulp1 T C 17: 28,364,494 K58E probably benign Het
Utp6 A G 11: 79,943,229 probably null Het
Vmn1r21 T C 6: 57,844,013 T149A probably benign Het
Vmn1r238 C T 18: 3,123,127 V96M probably benign Het
Vmn1r9 T A 6: 57,071,681 I247N probably damaging Het
Vps33b T C 7: 80,282,493 C138R possibly damaging Het
Wnk1 A T 6: 119,963,265 V837E probably damaging Het
Xirp2 C T 2: 67,482,363 H59Y possibly damaging Het
Zbtb38 G T 9: 96,686,381 D883E probably benign Het
Zbtb7a C A 10: 81,144,534 D187E probably benign Het
Zfp511 T C 7: 140,037,529 V148A probably damaging Het
Zfp52 A G 17: 21,560,430 D180G possibly damaging Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
R8339:Pacs1 UTSW 19 5142623 missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5138936 missense probably benign 0.23
R9211:Pacs1 UTSW 19 5139029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTAGAGACAAGCCCCAGTG -3'
(R):5'- TAAGAGCCAGGTCATCGAGG -3'

Sequencing Primer
(F):5'- CCAGTGCTGGGAAAGGG -3'
(R):5'- CAGGTCATCGAGGGCATCAG -3'
Posted On 2021-08-31