Incidental Mutation 'R8931:Pik3c2g'
ID 680306
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8931 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139587221-139969284 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139875367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 297 (T297A)
Ref Sequence ENSEMBL: ENSMUSP00000084939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: T297A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: T297A

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: T665A

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G C 17: 12,928,518 P204R probably damaging Het
Aldh3b1 A G 19: 3,918,803 I250T possibly damaging Het
Ankrd11 C T 8: 122,895,979 R378K probably damaging Het
Arap1 G A 7: 101,408,117 R1355Q possibly damaging Het
Arhgef19 T C 4: 141,249,292 V455A probably damaging Het
BC051019 T C 7: 109,716,079 E323G probably damaging Het
BC051142 T C 17: 34,440,354 probably benign Het
Bzw2 T C 12: 36,134,944 N2S possibly damaging Het
Calm3 G C 7: 16,917,473 F66L probably damaging Het
Carmil1 T A 13: 24,154,721 T191S probably benign Het
Cbwd1 T G 19: 24,955,416 K84N probably damaging Het
Cep170 A T 1: 176,769,811 C389S probably benign Het
Clhc1 C T 11: 29,560,533 Q195* probably null Het
Cttnbp2 A G 6: 18,434,809 L350P probably benign Het
Cyp7a1 T C 4: 6,271,238 E306G possibly damaging Het
Ddx25 T C 9: 35,554,568 N119S possibly damaging Het
Ephx2 G T 14: 66,084,992 probably benign Het
Ern2 C T 7: 122,170,140 A888T probably benign Het
Fbln2 A T 6: 91,269,090 I973F probably damaging Het
Fbn1 T C 2: 125,360,175 I1259M probably damaging Het
Glis1 A G 4: 107,563,863 H92R probably benign Het
Gm13283 A C 4: 88,761,279 D169A probably benign Het
Gm14085 C A 2: 122,518,502 P303Q Het
Gm8882 G A 6: 132,361,934 P107L Het
Gpr61 A G 3: 108,150,154 L397P probably benign Het
Hip1 A T 5: 135,431,443 probably benign Het
Hist1h4j T A 13: 21,735,199 I35N probably damaging Het
Hmgcs2 C T 3: 98,296,241 A222V probably damaging Het
Ifna2 G A 4: 88,683,475 T102I probably benign Het
Kat6b T C 14: 21,624,927 S387P probably damaging Het
Ldlr G A 9: 21,731,812 V45M probably damaging Het
Mc3r A T 2: 172,249,595 I246F possibly damaging Het
Mug1 G C 6: 121,884,337 A1306P probably benign Het
Myo15 A G 11: 60,477,194 E260G probably benign Het
Naa16 A G 14: 79,344,955 Y565H probably damaging Het
Ndufaf7 A G 17: 78,937,521 Y23C possibly damaging Het
Nop58 G A 1: 59,692,390 probably null Het
Olfr794 A T 10: 129,570,681 T9S probably benign Het
Olfr820 A T 10: 130,017,900 T180S possibly damaging Het
Olfr832 T A 9: 18,944,624 probably benign Het
Pcdh8 G A 14: 79,769,531 Q531* probably null Het
Poc1b T C 10: 99,192,999 probably null Het
Prokr2 A G 2: 132,374,076 V155A possibly damaging Het
Rce1 C T 19: 4,624,066 probably benign Het
Rnf148 A T 6: 23,654,705 N97K possibly damaging Het
Setbp1 A G 18: 78,856,508 S1315P probably benign Het
Sgcz A G 8: 37,639,986 V124A probably damaging Het
Slc25a2 C A 18: 37,638,036 G147C probably damaging Het
Sod2 T C 17: 13,008,306 L49P probably damaging Het
Tbc1d12 T C 19: 38,865,654 V260A probably benign Het
Tcte2 C A 17: 13,713,148 probably benign Het
Tenm3 T C 8: 48,235,602 T2317A probably damaging Het
Tfcp2 T C 15: 100,504,417 I500V possibly damaging Het
Tmem2 T A 19: 21,792,959 S104T probably benign Het
Trav14-3 C A 14: 53,763,655 Q108K probably damaging Het
Trbv14 T C 6: 41,135,430 Y54H probably damaging Het
Trpm3 T A 19: 22,766,670 V337E probably damaging Het
Uox A T 3: 146,612,292 I14F probably damaging Het
Wdfy3 A G 5: 101,917,555 V1249A probably benign Het
Zfp511 T C 7: 140,037,281 Y97H probably damaging Het
Zfp536 G T 7: 37,569,296 Q232K probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
R8888:Pik3c2g UTSW 6 139730366 nonsense probably null
R9188:Pik3c2g UTSW 6 139622403 missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139875435 missense
R9383:Pik3c2g UTSW 6 139882016 nonsense probably null
R9524:Pik3c2g UTSW 6 139629770 missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139896200 missense
R9630:Pik3c2g UTSW 6 139622239 missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139967791 missense unknown
R9708:Pik3c2g UTSW 6 139629867 missense probably benign
R9717:Pik3c2g UTSW 6 139896184 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTGCTGCAATAACCCAC -3'
(R):5'- GCCAAGAAACATGTTTGCTTGC -3'

Sequencing Primer
(F):5'- GATCTGCTGCAATAACCCACACTAG -3'
(R):5'- CAAGAAACATGTTTGCTTGCTCACTC -3'
Posted On 2021-08-31