Incidental Mutation 'R8932:Slc6a17'
ID 680353
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 068776-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R8932 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 107379507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 554 (Q554K)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably benign
Transcript: ENSMUST00000029499
AA Change: Q551K

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: Q551K

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168211
AA Change: Q513K

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: Q513K

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169449
AA Change: Q554K

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: Q554K

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,629,693 (GRCm39) probably null Het
Abl2 A G 1: 156,461,402 (GRCm39) T435A probably damaging Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Ass1 T A 2: 31,382,387 (GRCm39) M186K probably damaging Het
Bckdk A G 7: 127,507,182 (GRCm39) D312G probably benign Het
Btg3 T A 16: 78,170,298 (GRCm39) N3I probably benign Het
Cd163 T C 6: 124,294,882 (GRCm39) F649L probably damaging Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cnksr3 A T 10: 7,110,780 (GRCm39) V27E probably damaging Het
Col12a1 A T 9: 79,580,665 (GRCm39) S1512T probably benign Het
Cstf1 A G 2: 172,217,623 (GRCm39) T79A probably benign Het
Defa24 T C 8: 22,225,373 (GRCm39) Y88H probably benign Het
Dgkz C T 2: 91,769,915 (GRCm39) R389Q probably damaging Het
Dsg3 T A 18: 20,672,718 (GRCm39) D796E probably damaging Het
Dyrk3 G T 1: 131,057,293 (GRCm39) D293E probably damaging Het
Epb42 T C 2: 120,854,767 (GRCm39) D606G probably benign Het
Erich5 G A 15: 34,453,844 (GRCm39) G18S probably benign Het
Fam8a1 C T 13: 46,827,868 (GRCm39) T352M probably benign Het
Fastkd3 T A 13: 68,731,835 (GRCm39) L52Q probably benign Het
Fat3 G A 9: 15,910,819 (GRCm39) H1728Y probably benign Het
Fgl1 A G 8: 41,662,868 (GRCm39) V39A probably benign Het
Gm7298 T C 6: 121,742,030 (GRCm39) V484A probably benign Het
Gpr75 A G 11: 30,842,571 (GRCm39) Q492R possibly damaging Het
Hoxc8 A G 15: 102,899,318 (GRCm39) H36R possibly damaging Het
Insyn2a A G 7: 134,500,881 (GRCm39) I408T probably damaging Het
Insyn2b T C 11: 34,352,707 (GRCm39) S250P probably benign Het
Isy1 T C 6: 87,798,513 (GRCm39) I214V probably damaging Het
Kdm5b C T 1: 134,544,010 (GRCm39) P853L probably damaging Het
Man2b1 A G 8: 85,822,022 (GRCm39) T746A probably damaging Het
Mki67 A G 7: 135,300,628 (GRCm39) S1469P possibly damaging Het
Mrps30 C T 13: 118,523,695 (GRCm39) A26T probably benign Het
Mup10 T A 4: 60,536,708 (GRCm39) T92S possibly damaging Het
Otud7a A G 7: 63,407,239 (GRCm39) D514G possibly damaging Het
Pacs1 T A 19: 5,185,030 (GRCm39) S932C probably damaging Het
Pbx2 C T 17: 34,813,563 (GRCm39) R188C probably damaging Het
Pclo C T 5: 14,762,989 (GRCm39) P536S possibly damaging Het
Pdxdc1 A T 16: 13,672,269 (GRCm39) I377N probably damaging Het
Phip T C 9: 82,789,041 (GRCm39) K758E possibly damaging Het
Pramel34 T G 5: 93,785,944 (GRCm39) D112A probably benign Het
Ptprm C T 17: 67,263,846 (GRCm39) R467H probably benign Het
Rbm12b1 C T 4: 12,145,689 (GRCm39) R554C probably benign Het
Scnn1b C T 7: 121,502,067 (GRCm39) R242C probably damaging Het
Seh1l T C 18: 67,908,134 (GRCm39) S19P possibly damaging Het
Slc28a1 T A 7: 80,817,715 (GRCm39) V528D probably benign Het
Spag16 G A 1: 70,338,928 (GRCm39) probably null Het
Spata31d1e C T 13: 59,890,015 (GRCm39) E184K possibly damaging Het
Srfbp1 T A 18: 52,623,117 (GRCm39) N377K possibly damaging Het
Stap2 A G 17: 56,304,895 (GRCm39) S296P probably benign Het
Tnr A T 1: 159,740,359 (GRCm39) I1178F probably damaging Het
Tomt C T 7: 101,550,350 (GRCm39) A139T probably damaging Het
Trak2 T C 1: 58,974,967 (GRCm39) Q75R probably benign Het
Tulp1 T C 17: 28,583,468 (GRCm39) K58E probably benign Het
Utp6 A G 11: 79,834,055 (GRCm39) probably null Het
Vmn1r21 T C 6: 57,820,998 (GRCm39) T149A probably benign Het
Vmn1r238 C T 18: 3,123,127 (GRCm39) V96M probably benign Het
Vmn1r9 T A 6: 57,048,666 (GRCm39) I247N probably damaging Het
Vps33b T C 7: 79,932,241 (GRCm39) C138R possibly damaging Het
Wnk1 A T 6: 119,940,226 (GRCm39) V837E probably damaging Het
Xirp2 C T 2: 67,312,707 (GRCm39) H59Y possibly damaging Het
Zbtb38 G T 9: 96,568,434 (GRCm39) D883E probably benign Het
Zbtb7a C A 10: 80,980,368 (GRCm39) D187E probably benign Het
Zfp511 T C 7: 139,617,442 (GRCm39) V148A probably damaging Het
Zfp52 A G 17: 21,780,692 (GRCm39) D180G possibly damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAGAAGATGCCAGAGACTCTG -3'
(R):5'- AGGGCCTGTCTAATGGATCG -3'

Sequencing Primer
(F):5'- CAGAGACTCTGGGGTTTGTTG -3'
(R):5'- GGCCTGTCTAATGGATCGTATCTC -3'
Posted On 2021-08-31