Mutagenetix > Incidental Mutation

Incidental Mutation 'R8933:Kdsr'

680407

Institutional Source

Beutler Lab

Gene Symbol

Kdsr

Ensembl Gene

ENSMUSG00000009905

Gene Name

3-ketodihydrosphingosine reductase

Synonyms

Fvt1, 6330410P18Rik, 9430079B08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R8933 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106720459-106759727 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106753219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 83 (D83G)

Ref Sequence

ENSEMBL: ENSMUSP00000010049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010049]

AlphaFold

Q6GV12

Predicted Effect

possibly damaging
Transcript: ENSMUST00000010049
AA Change: D83G

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: D83G

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:KR	33	214	9.4e-16	PFAM
Pfam:adh_short	33	232	1.1e-59	PFAM
Pfam:adh_short_C2	39	217	5.7e-13	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,128,137	I1114N	probably damaging	Het
Ache	C	A	5: 137,290,187	R52S	possibly damaging	Het
AI182371	A	T	2: 35,085,702		probably null	Het
Ankrd17	T	C	5: 90,258,466	S1453G	probably damaging	Het
Arvcf	A	G	16: 18,400,095	N508S	probably damaging	Het
Aurkc	A	C	7: 7,002,797	D136A	possibly damaging	Het
Bfsp2	A	G	9: 103,448,649	M265T	probably benign	Het
Bmpr1b	T	C	3: 141,856,608	T273A	probably damaging	Het
Cacnb1	T	C	11: 98,005,752	K406R	probably damaging	Het
Calcoco2	C	T	11: 96,107,426		probably benign	Het
Capza1	T	C	3: 104,840,893		probably null	Het
Ccdc63	T	A	5: 122,113,202	I382F	probably damaging	Het
Cep350	A	T	1: 155,863,415	N2227K	probably benign	Het
Chia1	T	A	3: 106,129,017	Y304*	probably null	Het
Col5a2	G	A	1: 45,421,963	P258L		Het
Cyp21a1	A	G	17: 34,804,311	L30P	probably damaging	Het
Dennd4b	T	A	3: 90,279,216	H1351Q	probably benign	Het
Dnah9	T	A	11: 65,855,252	I4012F	possibly damaging	Het
Drd1	A	G	13: 54,053,271	I301T	possibly damaging	Het
Dzip1	T	A	14: 118,906,914	H369L	probably damaging	Het
Fgfrl1	T	A	5: 108,703,391	M58K	probably damaging	Het
Ftsj3	G	T	11: 106,250,834	D529E	probably benign	Het
Fut9	A	T	4: 25,619,861	W318R	probably damaging	Het
Gabrg3	A	G	7: 56,984,958	I159T	probably damaging	Het
Gabrr1	A	T	4: 33,146,972	D53V	probably benign	Het
Ggps1	A	G	13: 14,054,343	V85A	probably benign	Het
Gm5141	C	T	13: 62,777,040	W18*	probably null	Het
Grik5	T	A	7: 25,023,318	T518S	probably benign	Het
Hapln3	A	T	7: 79,117,630		probably benign	Het
Hbs1l	C	T	10: 21,367,685	Q646*	probably null	Het
Hmox1	T	C	8: 75,097,016	I104T	probably benign	Het
Ifit1bl1	T	C	19: 34,594,013	Y348C	probably damaging	Het
Igf2r	A	T	17: 12,701,244	S1403T	probably damaging	Het
Igf2r	G	A	17: 12,704,637	T1186M	probably damaging	Het
Igfbp1	T	C	11: 7,198,333		probably null	Het
Ikbip	C	A	10: 91,083,230	A35E	probably benign	Het
Isca1	C	T	13: 59,769,683	A8T	probably damaging	Het
Itgb2	T	C	10: 77,565,188	L754P	probably damaging	Het
Itgb6	C	T	2: 60,627,903	C502Y	probably damaging	Het
Kdm3a	A	G	6: 71,600,108	V741A	probably benign	Het
Kiz	T	A	2: 146,942,117	N523K		Het
Kmt2a	T	C	9: 44,822,505		probably benign	Het
Krt25	T	C	11: 99,321,238	E191G	probably benign	Het
Lipn	A	G	19: 34,069,480	I61V	probably damaging	Het
Lmbr1l	T	A	15: 98,909,269		probably null	Het
Lrrc4c	A	G	2: 97,629,481	K151E	probably benign	Het
Mab21l3	T	C	3: 101,823,458	Q155R	probably benign	Het
Mtfr2	G	A	10: 20,357,528	R281H	possibly damaging	Het
Muc5ac	A	G	7: 141,789,756	Y35C	possibly damaging	Het
Myadm	C	T	7: 3,296,917	T65I	probably benign	Het
Nap1l1	T	C	10: 111,492,849	V213A	probably benign	Het
Nav2	A	G	7: 49,461,957	D737G	probably damaging	Het
Ndst4	T	A	3: 125,611,506	V470D	probably damaging	Het
Nek5	T	A	8: 22,111,210	Y165F	probably damaging	Het
Nek5	A	T	8: 22,120,843	V48E	probably damaging	Het
Nr6a1	T	C	2: 38,760,388	I77V	probably damaging	Het
Nvl	A	T	1: 181,139,073	D93E	probably benign	Het
Olfr450	A	G	6: 42,818,016	T182A	probably benign	Het
Olfr552	A	T	7: 102,604,430	L25F	probably damaging	Het
Olfr656	A	T	7: 104,617,666	T4S	probably benign	Het
Olfr678	A	G	7: 105,069,392		probably benign	Het
Olfr780	A	T	10: 129,322,390	I256F	probably damaging	Het
Olfr96	C	A	17: 37,225,455	T110K	possibly damaging	Het
Pla2g4c	G	A	7: 13,339,702	V225I	probably benign	Het
Plppr4	T	A	3: 117,323,041	N331I	probably damaging	Het
Ptpn13	A	G	5: 103,579,805	R2051G	probably benign	Het
Rbm45	T	C	2: 76,378,724	S346P	probably damaging	Het
Samd14	A	C	11: 95,021,201	D168A	probably damaging	Het
Slc15a1	C	T	14: 121,486,679	G172R	probably benign	Het
Slco3a1	G	T	7: 74,284,500	Y641*	probably null	Het
Srcap	G	A	7: 127,552,394	R2027H	probably damaging	Het
Stra8	A	T	6: 34,927,689		probably benign	Het
Syt11	T	C	3: 88,747,704	Y430C	probably damaging	Het
Tanc1	T	G	2: 59,785,456	V269G	possibly damaging	Het
Tead1	A	G	7: 112,898,611	N342S	probably benign	Het
Tenm3	C	T	8: 48,279,060	A1254T	possibly damaging	Het
Txlnb	A	T	10: 17,806,798	N156I	probably damaging	Het
Ufl1	A	T	4: 25,262,258	S409R	possibly damaging	Het
Usp17la	A	G	7: 104,861,100	H304R	probably benign	Het
Vmn1r203	T	A	13: 22,524,521	H157Q	possibly damaging	Het
Vmn1r37	C	T	6: 66,732,247	R249*	probably null	Het
Vmn2r96	A	G	17: 18,583,979	Q497R	probably benign	Het
Vps39	A	G	2: 120,338,585	S292P	probably benign	Het
Wnk1	A	G	6: 120,036,998	V212A	probably damaging	Het
Xbp1	T	C	11: 5,524,741	V161A	probably benign	Het
Zfp113	T	C	5: 138,144,830	Q386R	probably damaging	Het

Other mutations in Kdsr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Kdsr	APN	1	106755457	missense	possibly damaging	0.91
IGL01375:Kdsr	APN	1	106727694	missense	probably benign	0.06
R0361:Kdsr	UTSW	1	106747787	missense	probably damaging	0.97
R1051:Kdsr	UTSW	1	106747580	nonsense	probably null
R1589:Kdsr	UTSW	1	106734541	splice site	probably null
R1679:Kdsr	UTSW	1	106753226	missense	probably benign	0.01
R4890:Kdsr	UTSW	1	106753234	missense	probably benign	0.21
R5392:Kdsr	UTSW	1	106753241	missense	possibly damaging	0.88
R5500:Kdsr	UTSW	1	106759644	unclassified	probably benign
R5830:Kdsr	UTSW	1	106747532	missense	possibly damaging	0.89
R5850:Kdsr	UTSW	1	106755442	critical splice donor site	probably null
R6005:Kdsr	UTSW	1	106734581	missense	probably benign	0.01
R7515:Kdsr	UTSW	1	106734560	missense	possibly damaging	0.89
R7841:Kdsr	UTSW	1	106743685	missense	probably damaging	1.00
R8282:Kdsr	UTSW	1	106724997	missense	probably benign	0.03
R8312:Kdsr	UTSW	1	106747486	critical splice donor site	probably null
R8392:Kdsr	UTSW	1	106743853	missense	probably damaging	1.00
R8507:Kdsr	UTSW	1	106743670	missense	probably null	1.00
R9531:Kdsr	UTSW	1	106739333	missense	probably damaging	0.99
R9740:Kdsr	UTSW	1	106739396	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CCATCTGGTTTCTGTACAGAGAC -3'
(R):5'- ACTTACCTGGGCTCTTAGGTG -3'

Sequencing Primer
(F):5'- CTGTACAGAGACCTGAATTCTAGTC -3'
(R):5'- TACCTGGGCTCTTAGGTGTTTTGC -3'

Posted On

2021-08-31