Mutagenetix > Incidental Mutation

Incidental Mutation 'R8933:Ptpn13'

680431

Institutional Source

Beutler Lab

Gene Symbol

Ptpn13

Ensembl Gene

ENSMUSG00000034573

Gene Name

protein tyrosine phosphatase, non-receptor type 13

Synonyms

PTPL1, Ptpri, PTP-BL

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R8933 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103425192-103598303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103579805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 2051 (R2051G)

Ref Sequence

ENSEMBL: ENSMUSP00000048119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048957]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048957
AA Change: R2051G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: R2051G

Domain	Start	End	E-Value	Type
KIND	3	190	2.3e-80	SMART
Blast:B41	340	447	6e-34	BLAST
coiled coil region	460	487	N/A	INTRINSIC
B41	561	774	3.3e-68	SMART
FERM_C	780	869	3.2e-35	SMART
low complexity region	1049	1058	N/A	INTRINSIC
PDZ	1093	1170	7.6e-25	SMART
low complexity region	1224	1236	N/A	INTRINSIC
low complexity region	1309	1322	N/A	INTRINSIC
low complexity region	1331	1341	N/A	INTRINSIC
PDZ	1365	1442	1.7e-24	SMART
low complexity region	1450	1468	N/A	INTRINSIC
PDZ	1499	1579	3.5e-19	SMART
PDZ	1773	1845	1.2e-21	SMART
PDZ	1867	1942	1.6e-16	SMART
low complexity region	2123	2134	N/A	INTRINSIC
PTPc	2179	2436	6.9e-113	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,128,137	I1114N	probably damaging	Het
Ache	C	A	5: 137,290,187	R52S	possibly damaging	Het
AI182371	A	T	2: 35,085,702		probably null	Het
Ankrd17	T	C	5: 90,258,466	S1453G	probably damaging	Het
Arvcf	A	G	16: 18,400,095	N508S	probably damaging	Het
Aurkc	A	C	7: 7,002,797	D136A	possibly damaging	Het
Bfsp2	A	G	9: 103,448,649	M265T	probably benign	Het
Bmpr1b	T	C	3: 141,856,608	T273A	probably damaging	Het
Cacnb1	T	C	11: 98,005,752	K406R	probably damaging	Het
Calcoco2	C	T	11: 96,107,426		probably benign	Het
Capza1	T	C	3: 104,840,893		probably null	Het
Ccdc63	T	A	5: 122,113,202	I382F	probably damaging	Het
Cep350	A	T	1: 155,863,415	N2227K	probably benign	Het
Chia1	T	A	3: 106,129,017	Y304*	probably null	Het
Col5a2	G	A	1: 45,421,963	P258L		Het
Cyp21a1	A	G	17: 34,804,311	L30P	probably damaging	Het
Dennd4b	T	A	3: 90,279,216	H1351Q	probably benign	Het
Dnah9	T	A	11: 65,855,252	I4012F	possibly damaging	Het
Drd1	A	G	13: 54,053,271	I301T	possibly damaging	Het
Dzip1	T	A	14: 118,906,914	H369L	probably damaging	Het
Fgfrl1	T	A	5: 108,703,391	M58K	probably damaging	Het
Ftsj3	G	T	11: 106,250,834	D529E	probably benign	Het
Fut9	A	T	4: 25,619,861	W318R	probably damaging	Het
Gabrg3	A	G	7: 56,984,958	I159T	probably damaging	Het
Gabrr1	A	T	4: 33,146,972	D53V	probably benign	Het
Ggps1	A	G	13: 14,054,343	V85A	probably benign	Het
Gm5141	C	T	13: 62,777,040	W18*	probably null	Het
Grik5	T	A	7: 25,023,318	T518S	probably benign	Het
Hapln3	A	T	7: 79,117,630		probably benign	Het
Hbs1l	C	T	10: 21,367,685	Q646*	probably null	Het
Hmox1	T	C	8: 75,097,016	I104T	probably benign	Het
Ifit1bl1	T	C	19: 34,594,013	Y348C	probably damaging	Het
Igf2r	A	T	17: 12,701,244	S1403T	probably damaging	Het
Igf2r	G	A	17: 12,704,637	T1186M	probably damaging	Het
Igfbp1	T	C	11: 7,198,333		probably null	Het
Ikbip	C	A	10: 91,083,230	A35E	probably benign	Het
Isca1	C	T	13: 59,769,683	A8T	probably damaging	Het
Itgb2	T	C	10: 77,565,188	L754P	probably damaging	Het
Itgb6	C	T	2: 60,627,903	C502Y	probably damaging	Het
Kdm3a	A	G	6: 71,600,108	V741A	probably benign	Het
Kdsr	T	C	1: 106,753,219	D83G	possibly damaging	Het
Kiz	T	A	2: 146,942,117	N523K		Het
Kmt2a	T	C	9: 44,822,505		probably benign	Het
Krt25	T	C	11: 99,321,238	E191G	probably benign	Het
Lipn	A	G	19: 34,069,480	I61V	probably damaging	Het
Lmbr1l	T	A	15: 98,909,269		probably null	Het
Lrrc4c	A	G	2: 97,629,481	K151E	probably benign	Het
Mab21l3	T	C	3: 101,823,458	Q155R	probably benign	Het
Mtfr2	G	A	10: 20,357,528	R281H	possibly damaging	Het
Muc5ac	A	G	7: 141,789,756	Y35C	possibly damaging	Het
Myadm	C	T	7: 3,296,917	T65I	probably benign	Het
Nap1l1	T	C	10: 111,492,849	V213A	probably benign	Het
Nav2	A	G	7: 49,461,957	D737G	probably damaging	Het
Ndst4	T	A	3: 125,611,506	V470D	probably damaging	Het
Nek5	T	A	8: 22,111,210	Y165F	probably damaging	Het
Nek5	A	T	8: 22,120,843	V48E	probably damaging	Het
Nr6a1	T	C	2: 38,760,388	I77V	probably damaging	Het
Nvl	A	T	1: 181,139,073	D93E	probably benign	Het
Olfr450	A	G	6: 42,818,016	T182A	probably benign	Het
Olfr552	A	T	7: 102,604,430	L25F	probably damaging	Het
Olfr656	A	T	7: 104,617,666	T4S	probably benign	Het
Olfr678	A	G	7: 105,069,392		probably benign	Het
Olfr780	A	T	10: 129,322,390	I256F	probably damaging	Het
Olfr96	C	A	17: 37,225,455	T110K	possibly damaging	Het
Pla2g4c	G	A	7: 13,339,702	V225I	probably benign	Het
Plppr4	T	A	3: 117,323,041	N331I	probably damaging	Het
Rbm45	T	C	2: 76,378,724	S346P	probably damaging	Het
Samd14	A	C	11: 95,021,201	D168A	probably damaging	Het
Slc15a1	C	T	14: 121,486,679	G172R	probably benign	Het
Slco3a1	G	T	7: 74,284,500	Y641*	probably null	Het
Srcap	G	A	7: 127,552,394	R2027H	probably damaging	Het
Stra8	A	T	6: 34,927,689		probably benign	Het
Syt11	T	C	3: 88,747,704	Y430C	probably damaging	Het
Tanc1	T	G	2: 59,785,456	V269G	possibly damaging	Het
Tead1	A	G	7: 112,898,611	N342S	probably benign	Het
Tenm3	C	T	8: 48,279,060	A1254T	possibly damaging	Het
Txlnb	A	T	10: 17,806,798	N156I	probably damaging	Het
Ufl1	A	T	4: 25,262,258	S409R	possibly damaging	Het
Usp17la	A	G	7: 104,861,100	H304R	probably benign	Het
Vmn1r203	T	A	13: 22,524,521	H157Q	possibly damaging	Het
Vmn1r37	C	T	6: 66,732,247	R249*	probably null	Het
Vmn2r96	A	G	17: 18,583,979	Q497R	probably benign	Het
Vps39	A	G	2: 120,338,585	S292P	probably benign	Het
Wnk1	A	G	6: 120,036,998	V212A	probably damaging	Het
Xbp1	T	C	11: 5,524,741	V161A	probably benign	Het
Zfp113	T	C	5: 138,144,830	Q386R	probably damaging	Het

Other mutations in Ptpn13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptpn13	APN	5	103551058	missense	probably damaging	1.00
IGL00569:Ptpn13	APN	5	103591006	splice site	probably benign
IGL00764:Ptpn13	APN	5	103597718	missense	probably damaging	1.00
IGL00805:Ptpn13	APN	5	103554729	missense	probably benign	0.33
IGL00922:Ptpn13	APN	5	103588088	missense	probably damaging	1.00
IGL00959:Ptpn13	APN	5	103517571	critical splice donor site	probably null
IGL01090:Ptpn13	APN	5	103541314	missense	probably null	0.80
IGL01352:Ptpn13	APN	5	103486775	splice site	probably null
IGL01510:Ptpn13	APN	5	103562300	missense	probably damaging	1.00
IGL01515:Ptpn13	APN	5	103556113	missense	probably benign	0.06
IGL01896:Ptpn13	APN	5	103501523	missense	possibly damaging	0.78
IGL02094:Ptpn13	APN	5	103594617	missense	probably damaging	1.00
IGL02561:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02562:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02567:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02604:Ptpn13	APN	5	103501903	missense	probably benign	0.01
IGL02679:Ptpn13	APN	5	103569454	missense	possibly damaging	0.55
IGL02981:Ptpn13	APN	5	103528804	missense	probably damaging	1.00
IGL03131:Ptpn13	APN	5	103517559	missense	probably benign
IGL03136:Ptpn13	APN	5	103543463	missense	possibly damaging	0.49
IGL03163:Ptpn13	APN	5	103591346	missense	probably damaging	1.00
IGL03271:Ptpn13	APN	5	103462148	missense	probably damaging	1.00
IGL03297:Ptpn13	APN	5	103541077	missense	probably benign	0.13
IGL03328:Ptpn13	APN	5	103516348	missense	probably benign	0.00
IGL03343:Ptpn13	APN	5	103554950	missense	possibly damaging	0.88
IGL02835:Ptpn13	UTSW	5	103560025	missense	probably damaging	0.98
P0021:Ptpn13	UTSW	5	103528820	missense	probably benign	0.39
R0017:Ptpn13	UTSW	5	103486772	critical splice donor site	probably null
R0090:Ptpn13	UTSW	5	103569503	missense	probably damaging	1.00
R0111:Ptpn13	UTSW	5	103580763	splice site	probably benign
R0183:Ptpn13	UTSW	5	103516408	missense	probably benign	0.00
R0230:Ptpn13	UTSW	5	103527131	missense	probably damaging	1.00
R0302:Ptpn13	UTSW	5	103565225	missense	probably benign
R0360:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0364:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0388:Ptpn13	UTSW	5	103555062	missense	probably benign	0.31
R0504:Ptpn13	UTSW	5	103501496	missense	possibly damaging	0.92
R0558:Ptpn13	UTSW	5	103529717	missense	probably damaging	0.99
R0562:Ptpn13	UTSW	5	103516425	critical splice donor site	probably null
R0568:Ptpn13	UTSW	5	103489765	missense	probably damaging	1.00
R0609:Ptpn13	UTSW	5	103556145	missense	probably benign
R0669:Ptpn13	UTSW	5	103556109	missense	probably benign
R0739:Ptpn13	UTSW	5	103575132	missense	probably benign
R1006:Ptpn13	UTSW	5	103586789	missense	probably benign	0.04
R1164:Ptpn13	UTSW	5	103489773	missense	probably damaging	1.00
R1274:Ptpn13	UTSW	5	103550260	missense	probably damaging	0.98
R1501:Ptpn13	UTSW	5	103516364	missense	probably benign	0.01
R1529:Ptpn13	UTSW	5	103564132	missense	probably benign	0.00
R1533:Ptpn13	UTSW	5	103556178	nonsense	probably null
R1613:Ptpn13	UTSW	5	103536871	missense	possibly damaging	0.89
R1616:Ptpn13	UTSW	5	103565237	missense	possibly damaging	0.49
R1830:Ptpn13	UTSW	5	103543459	missense	probably benign	0.00
R1892:Ptpn13	UTSW	5	103501679	missense	possibly damaging	0.92
R1907:Ptpn13	UTSW	5	103580709	missense	probably null	0.45
R2143:Ptpn13	UTSW	5	103556133	missense	probably benign
R2145:Ptpn13	UTSW	5	103556133	missense	probably benign
R2151:Ptpn13	UTSW	5	103525785	missense	probably damaging	1.00
R2180:Ptpn13	UTSW	5	103569558	missense	probably damaging	1.00
R2264:Ptpn13	UTSW	5	103489661	missense	possibly damaging	0.96
R2313:Ptpn13	UTSW	5	103564161	missense	probably damaging	1.00
R3522:Ptpn13	UTSW	5	103589854	splice site	probably benign
R3773:Ptpn13	UTSW	5	103477121	missense	probably damaging	1.00
R3924:Ptpn13	UTSW	5	103550741	splice site	probably benign
R4289:Ptpn13	UTSW	5	103533285	missense	probably damaging	1.00
R4348:Ptpn13	UTSW	5	103569726	missense	probably damaging	1.00
R4385:Ptpn13	UTSW	5	103533407	splice site	probably null
R4526:Ptpn13	UTSW	5	103501469	missense	probably benign	0.32
R4557:Ptpn13	UTSW	5	103541110	missense	probably damaging	1.00
R4596:Ptpn13	UTSW	5	103523692	missense	probably benign	0.06
R4632:Ptpn13	UTSW	5	103569860	missense	possibly damaging	0.46
R4727:Ptpn13	UTSW	5	103569855	missense	probably benign
R4780:Ptpn13	UTSW	5	103586773	missense	probably benign	0.04
R4793:Ptpn13	UTSW	5	103582778	critical splice donor site	probably null
R4812:Ptpn13	UTSW	5	103523615	missense	probably benign	0.00
R4939:Ptpn13	UTSW	5	103517469	splice site	probably null
R4951:Ptpn13	UTSW	5	103588046	missense	probably benign	0.00
R5052:Ptpn13	UTSW	5	103561980	missense	probably damaging	1.00
R5148:Ptpn13	UTSW	5	103492232	missense	probably damaging	1.00
R5309:Ptpn13	UTSW	5	103541053	missense	probably damaging	1.00
R5521:Ptpn13	UTSW	5	103501428	missense	probably benign	0.03
R5545:Ptpn13	UTSW	5	103561964	missense	probably damaging	1.00
R5696:Ptpn13	UTSW	5	103554759	missense	probably benign	0.20
R5735:Ptpn13	UTSW	5	103554820	missense	probably benign	0.03
R5815:Ptpn13	UTSW	5	103597690	splice site	probably null
R5876:Ptpn13	UTSW	5	103476960	missense	probably damaging	1.00
R5878:Ptpn13	UTSW	5	103477118	missense	possibly damaging	0.89
R6366:Ptpn13	UTSW	5	103551053	missense	probably damaging	1.00
R6455:Ptpn13	UTSW	5	103541284	missense	probably benign	0.00
R6492:Ptpn13	UTSW	5	103501612	missense	probably benign	0.02
R6709:Ptpn13	UTSW	5	103586756	missense	probably benign	0.18
R6759:Ptpn13	UTSW	5	103565255	missense	possibly damaging	0.49
R6944:Ptpn13	UTSW	5	103476991	missense	probably null	1.00
R7079:Ptpn13	UTSW	5	103501886	missense	probably benign	0.00
R7253:Ptpn13	UTSW	5	103565284	missense	possibly damaging	0.68
R7254:Ptpn13	UTSW	5	103594636	missense	probably damaging	1.00
R7391:Ptpn13	UTSW	5	103540981	missense	probably damaging	1.00
R7451:Ptpn13	UTSW	5	103527095	missense	probably benign	0.16
R7614:Ptpn13	UTSW	5	103501465	missense	probably benign	0.13
R7652:Ptpn13	UTSW	5	103529712	missense	probably benign	0.12
R7655:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7656:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7683:Ptpn13	UTSW	5	103565152	missense	probably benign	0.01
R7734:Ptpn13	UTSW	5	103561962	missense	probably damaging	1.00
R7794:Ptpn13	UTSW	5	103492224	missense	probably benign	0.06
R7834:Ptpn13	UTSW	5	103462148	missense	probably damaging	1.00
R7911:Ptpn13	UTSW	5	103541058	missense	probably damaging	1.00
R8010:Ptpn13	UTSW	5	103559937	nonsense	probably null
R8308:Ptpn13	UTSW	5	103540972	missense	probably damaging	0.99
R8493:Ptpn13	UTSW	5	103564165	missense	probably damaging	1.00
R8493:Ptpn13	UTSW	5	103569805	missense	probably benign	0.01
R8507:Ptpn13	UTSW	5	103557949	missense	probably damaging	1.00
R8556:Ptpn13	UTSW	5	103559172	missense	probably damaging	1.00
R8924:Ptpn13	UTSW	5	103591235	missense	probably damaging	1.00
R8958:Ptpn13	UTSW	5	103551107	missense	probably benign	0.15
R8975:Ptpn13	UTSW	5	103501400	missense	probably benign	0.32
R9080:Ptpn13	UTSW	5	103489628	missense	probably damaging	0.99
R9091:Ptpn13	UTSW	5	103501869	missense	possibly damaging	0.67
R9219:Ptpn13	UTSW	5	103597766	missense	probably benign	0.16
R9270:Ptpn13	UTSW	5	103501869	missense	possibly damaging	0.67
R9577:Ptpn13	UTSW	5	103528809	missense	probably damaging	1.00
R9593:Ptpn13	UTSW	5	103527132	missense	possibly damaging	0.94
R9705:Ptpn13	UTSW	5	103533355	missense	possibly damaging	0.89
RF017:Ptpn13	UTSW	5	103593580	missense	probably benign	0.45
Z1177:Ptpn13	UTSW	5	103569556	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTAGGAGACCATGTCTAC -3'
(R):5'- AAGCTGGCTCACTCATCTGG -3'

Sequencing Primer
(F):5'- GAGACCATGTCTACCCTTTAGAGG -3'
(R):5'- GGCTCACTCATCTGGCTCCTC -3'

Posted On

2021-08-31