Incidental Mutation 'R8933:Fgfrl1'
ID 680432
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Name fibroblast growth factor receptor-like 1
Synonyms FGFR5gamma, fibroblast growth factor receptor 5, FGFR5, FGFR5beta
MMRRC Submission 068709-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 108842051-108854816 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108851257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 58 (M58K)
Ref Sequence ENSEMBL: ENSMUSP00000143037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
AlphaFold Q91V87
Predicted Effect probably damaging
Transcript: ENSMUST00000013633
AA Change: M58K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: M58K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112560
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196222
AA Change: M58K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090
AA Change: M58K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,921,786 (GRCm39) I1114N probably damaging Het
Ache C A 5: 137,288,449 (GRCm39) R52S possibly damaging Het
AI182371 A T 2: 34,975,714 (GRCm39) probably null Het
Ankrd17 T C 5: 90,406,325 (GRCm39) S1453G probably damaging Het
Arvcf A G 16: 18,218,845 (GRCm39) N508S probably damaging Het
Aurkc A C 7: 7,005,796 (GRCm39) D136A possibly damaging Het
Bfsp2 A G 9: 103,325,848 (GRCm39) M265T probably benign Het
Bmpr1b T C 3: 141,562,369 (GRCm39) T273A probably damaging Het
Cacnb1 T C 11: 97,896,578 (GRCm39) K406R probably damaging Het
Calcoco2 C T 11: 95,998,252 (GRCm39) probably benign Het
Capza1 T C 3: 104,748,209 (GRCm39) probably null Het
Ccdc63 T A 5: 122,251,265 (GRCm39) I382F probably damaging Het
Cep350 A T 1: 155,739,161 (GRCm39) N2227K probably benign Het
Chia1 T A 3: 106,036,333 (GRCm39) Y304* probably null Het
Col5a2 G A 1: 45,461,123 (GRCm39) P258L Het
Cyp21a1 A G 17: 35,023,285 (GRCm39) L30P probably damaging Het
Dennd4b T A 3: 90,186,523 (GRCm39) H1351Q probably benign Het
Dnah9 T A 11: 65,746,078 (GRCm39) I4012F possibly damaging Het
Drd1 A G 13: 54,207,290 (GRCm39) I301T possibly damaging Het
Dzip1 T A 14: 119,144,326 (GRCm39) H369L probably damaging Het
Ftsj3 G T 11: 106,141,660 (GRCm39) D529E probably benign Het
Fut9 A T 4: 25,619,861 (GRCm39) W318R probably damaging Het
Gabrg3 A G 7: 56,634,706 (GRCm39) I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 (GRCm39) D53V probably benign Het
Ggps1 A G 13: 14,228,928 (GRCm39) V85A probably benign Het
Gm5141 C T 13: 62,924,854 (GRCm39) W18* probably null Het
Grik5 T A 7: 24,722,743 (GRCm39) T518S probably benign Het
Hapln3 A T 7: 78,767,378 (GRCm39) probably benign Het
Hbs1l C T 10: 21,243,584 (GRCm39) Q646* probably null Het
Hmox1 T C 8: 75,823,644 (GRCm39) I104T probably benign Het
Ifit1bl1 T C 19: 34,571,413 (GRCm39) Y348C probably damaging Het
Igf2r A T 17: 12,920,131 (GRCm39) S1403T probably damaging Het
Igf2r G A 17: 12,923,524 (GRCm39) T1186M probably damaging Het
Igfbp1 T C 11: 7,148,333 (GRCm39) probably null Het
Ikbip C A 10: 90,919,092 (GRCm39) A35E probably benign Het
Isca1 C T 13: 59,917,497 (GRCm39) A8T probably damaging Het
Itgb2 T C 10: 77,401,022 (GRCm39) L754P probably damaging Het
Itgb6 C T 2: 60,458,247 (GRCm39) C502Y probably damaging Het
Kdm3a A G 6: 71,577,092 (GRCm39) V741A probably benign Het
Kdsr T C 1: 106,680,949 (GRCm39) D83G possibly damaging Het
Kiz T A 2: 146,784,037 (GRCm39) N523K Het
Kmt2a T C 9: 44,733,802 (GRCm39) probably benign Het
Krt25 T C 11: 99,212,064 (GRCm39) E191G probably benign Het
Lipn A G 19: 34,046,880 (GRCm39) I61V probably damaging Het
Lmbr1l T A 15: 98,807,150 (GRCm39) probably null Het
Lrrc4c A G 2: 97,459,826 (GRCm39) K151E probably benign Het
Mab21l3 T C 3: 101,730,774 (GRCm39) Q155R probably benign Het
Mtfr2 G A 10: 20,233,274 (GRCm39) R281H possibly damaging Het
Muc5ac A G 7: 141,343,493 (GRCm39) Y35C possibly damaging Het
Myadm C T 7: 3,345,433 (GRCm39) T65I probably benign Het
Nap1l1 T C 10: 111,328,710 (GRCm39) V213A probably benign Het
Nav2 A G 7: 49,111,705 (GRCm39) D737G probably damaging Het
Ndst4 T A 3: 125,405,155 (GRCm39) V470D probably damaging Het
Nek5 T A 8: 22,601,226 (GRCm39) Y165F probably damaging Het
Nek5 A T 8: 22,610,859 (GRCm39) V48E probably damaging Het
Nr6a1 T C 2: 38,650,400 (GRCm39) I77V probably damaging Het
Nvl A T 1: 180,966,638 (GRCm39) D93E probably benign Het
Or11a4 C A 17: 37,536,346 (GRCm39) T110K possibly damaging Het
Or2q1 A G 6: 42,794,950 (GRCm39) T182A probably benign Het
Or52e5 A G 7: 104,718,599 (GRCm39) probably benign Het
Or52k2 A T 7: 102,253,637 (GRCm39) L25F probably damaging Het
Or52p1 A T 7: 104,266,873 (GRCm39) T4S probably benign Het
Or6c68 A T 10: 129,158,259 (GRCm39) I256F probably damaging Het
Pla2g4c G A 7: 13,073,627 (GRCm39) V225I probably benign Het
Plppr4 T A 3: 117,116,690 (GRCm39) N331I probably damaging Het
Ptpn13 A G 5: 103,727,671 (GRCm39) R2051G probably benign Het
Rbm45 T C 2: 76,209,068 (GRCm39) S346P probably damaging Het
Samd14 A C 11: 94,912,027 (GRCm39) D168A probably damaging Het
Slc15a1 C T 14: 121,724,091 (GRCm39) G172R probably benign Het
Slco3a1 G T 7: 73,934,248 (GRCm39) Y641* probably null Het
Srcap G A 7: 127,151,566 (GRCm39) R2027H probably damaging Het
Stra8 A T 6: 34,904,624 (GRCm39) probably benign Het
Syt11 T C 3: 88,655,011 (GRCm39) Y430C probably damaging Het
Tanc1 T G 2: 59,615,800 (GRCm39) V269G possibly damaging Het
Tead1 A G 7: 112,497,818 (GRCm39) N342S probably benign Het
Tenm3 C T 8: 48,732,095 (GRCm39) A1254T possibly damaging Het
Txlnb A T 10: 17,682,546 (GRCm39) N156I probably damaging Het
Ufl1 A T 4: 25,262,258 (GRCm39) S409R possibly damaging Het
Usp17la A G 7: 104,510,307 (GRCm39) H304R probably benign Het
Vmn1r203 T A 13: 22,708,691 (GRCm39) H157Q possibly damaging Het
Vmn1r37 C T 6: 66,709,231 (GRCm39) R249* probably null Het
Vmn2r96 A G 17: 18,804,241 (GRCm39) Q497R probably benign Het
Vps39 A G 2: 120,169,066 (GRCm39) S292P probably benign Het
Wnk1 A G 6: 120,013,959 (GRCm39) V212A probably damaging Het
Xbp1 T C 11: 5,474,741 (GRCm39) V161A probably benign Het
Zfp113 T C 5: 138,143,092 (GRCm39) Q386R probably damaging Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108,853,753 (GRCm39) missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108,853,819 (GRCm39) missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108,853,731 (GRCm39) missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108,852,539 (GRCm39) missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108,854,147 (GRCm39) unclassified probably benign
R1967:Fgfrl1 UTSW 5 108,852,871 (GRCm39) missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108,852,897 (GRCm39) missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108,853,926 (GRCm39) missense probably benign 0.13
R3605:Fgfrl1 UTSW 5 108,853,289 (GRCm39) missense probably damaging 0.96
R3606:Fgfrl1 UTSW 5 108,853,289 (GRCm39) missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108,853,289 (GRCm39) missense probably damaging 0.96
R3767:Fgfrl1 UTSW 5 108,853,242 (GRCm39) missense possibly damaging 0.78
R4603:Fgfrl1 UTSW 5 108,851,401 (GRCm39) missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108,851,363 (GRCm39) nonsense probably null
R5600:Fgfrl1 UTSW 5 108,853,168 (GRCm39) missense probably damaging 1.00
R6349:Fgfrl1 UTSW 5 108,853,372 (GRCm39) missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108,852,839 (GRCm39) missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108,852,838 (GRCm39) nonsense probably null
R7247:Fgfrl1 UTSW 5 108,851,365 (GRCm39) missense possibly damaging 0.91
R7608:Fgfrl1 UTSW 5 108,853,211 (GRCm39) missense probably damaging 1.00
R7947:Fgfrl1 UTSW 5 108,853,142 (GRCm39) missense probably damaging 0.96
R9039:Fgfrl1 UTSW 5 108,853,439 (GRCm39) critical splice donor site probably null
R9661:Fgfrl1 UTSW 5 108,853,841 (GRCm39) missense probably benign
X0018:Fgfrl1 UTSW 5 108,852,840 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTCAGTGGAGTCCAGGTG -3'
(R):5'- CAATTTTGGCCCCACCGTAATC -3'

Sequencing Primer
(F):5'- GGGGTTCCACTGTGTCAAGC -3'
(R):5'- GTAATCTCTGACTTGAACACCAACTG -3'
Posted On 2021-08-31