Mutagenetix > Incidental Mutation

Incidental Mutation 'R8933:Ache'

680434

Institutional Source

Beutler Lab

Gene Symbol

Ache

Ensembl Gene

ENSMUSG00000023328

Gene Name

acetylcholinesterase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.799) question?

Stock #

R8933 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137287519-137294466 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 137290187 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 52 (R52S)

Ref Sequence

ENSEMBL: ENSMUSP00000142427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000141123] [ENSMUST00000196208]

AlphaFold

P21836

Predicted Effect

probably benign
Transcript: ENSMUST00000024099
AA Change: R52S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: R52S

Domain	Start	End	E-Value	Type
Pfam:COesterase	14	563	2e-186	PFAM
Pfam:Abhydrolase_3	146	276	7.5e-9	PFAM
Pfam:AChE_tetra	578	614	3.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000052825

SMART Domains

Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C78	27	212	5.4e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085934
AA Change: R52S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: R52S

Domain	Start	End	E-Value	Type
Pfam:COesterase	15	563	3e-178	PFAM
Pfam:Abhydrolase_3	146	260	1.4e-7	PFAM
Pfam:AChE_tetra	578	613	3.2e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125195

Predicted Effect

probably benign
Transcript: ENSMUST00000132191

Predicted Effect

probably benign
Transcript: ENSMUST00000137126

Predicted Effect

probably benign
Transcript: ENSMUST00000138591

Predicted Effect

probably benign
Transcript: ENSMUST00000141123

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196208
AA Change: R52S

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: R52S

Domain	Start	End	E-Value	Type
Pfam:COesterase	14	359	6.5e-134	PFAM
Pfam:Abhydrolase_3	146	284	4.1e-7	PFAM
Pfam:COesterase	355	475	1.5e-25	PFAM
Pfam:AChE_tetra	490	526	2.2e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,128,137	I1114N	probably damaging	Het
AI182371	A	T	2: 35,085,702		probably null	Het
Ankrd17	T	C	5: 90,258,466	S1453G	probably damaging	Het
Arvcf	A	G	16: 18,400,095	N508S	probably damaging	Het
Aurkc	A	C	7: 7,002,797	D136A	possibly damaging	Het
Bfsp2	A	G	9: 103,448,649	M265T	probably benign	Het
Bmpr1b	T	C	3: 141,856,608	T273A	probably damaging	Het
Cacnb1	T	C	11: 98,005,752	K406R	probably damaging	Het
Calcoco2	C	T	11: 96,107,426		probably benign	Het
Capza1	T	C	3: 104,840,893		probably null	Het
Ccdc63	T	A	5: 122,113,202	I382F	probably damaging	Het
Cep350	A	T	1: 155,863,415	N2227K	probably benign	Het
Chia1	T	A	3: 106,129,017	Y304*	probably null	Het
Col5a2	G	A	1: 45,421,963	P258L		Het
Cyp21a1	A	G	17: 34,804,311	L30P	probably damaging	Het
Dennd4b	T	A	3: 90,279,216	H1351Q	probably benign	Het
Dnah9	T	A	11: 65,855,252	I4012F	possibly damaging	Het
Drd1	A	G	13: 54,053,271	I301T	possibly damaging	Het
Dzip1	T	A	14: 118,906,914	H369L	probably damaging	Het
Fgfrl1	T	A	5: 108,703,391	M58K	probably damaging	Het
Ftsj3	G	T	11: 106,250,834	D529E	probably benign	Het
Fut9	A	T	4: 25,619,861	W318R	probably damaging	Het
Gabrg3	A	G	7: 56,984,958	I159T	probably damaging	Het
Gabrr1	A	T	4: 33,146,972	D53V	probably benign	Het
Ggps1	A	G	13: 14,054,343	V85A	probably benign	Het
Gm5141	C	T	13: 62,777,040	W18*	probably null	Het
Grik5	T	A	7: 25,023,318	T518S	probably benign	Het
Hapln3	A	T	7: 79,117,630		probably benign	Het
Hbs1l	C	T	10: 21,367,685	Q646*	probably null	Het
Hmox1	T	C	8: 75,097,016	I104T	probably benign	Het
Ifit1bl1	T	C	19: 34,594,013	Y348C	probably damaging	Het
Igf2r	A	T	17: 12,701,244	S1403T	probably damaging	Het
Igf2r	G	A	17: 12,704,637	T1186M	probably damaging	Het
Igfbp1	T	C	11: 7,198,333		probably null	Het
Ikbip	C	A	10: 91,083,230	A35E	probably benign	Het
Isca1	C	T	13: 59,769,683	A8T	probably damaging	Het
Itgb2	T	C	10: 77,565,188	L754P	probably damaging	Het
Itgb6	C	T	2: 60,627,903	C502Y	probably damaging	Het
Kdm3a	A	G	6: 71,600,108	V741A	probably benign	Het
Kdsr	T	C	1: 106,753,219	D83G	possibly damaging	Het
Kiz	T	A	2: 146,942,117	N523K		Het
Kmt2a	T	C	9: 44,822,505		probably benign	Het
Krt25	T	C	11: 99,321,238	E191G	probably benign	Het
Lipn	A	G	19: 34,069,480	I61V	probably damaging	Het
Lmbr1l	T	A	15: 98,909,269		probably null	Het
Lrrc4c	A	G	2: 97,629,481	K151E	probably benign	Het
Mab21l3	T	C	3: 101,823,458	Q155R	probably benign	Het
Mtfr2	G	A	10: 20,357,528	R281H	possibly damaging	Het
Muc5ac	A	G	7: 141,789,756	Y35C	possibly damaging	Het
Myadm	C	T	7: 3,296,917	T65I	probably benign	Het
Nap1l1	T	C	10: 111,492,849	V213A	probably benign	Het
Nav2	A	G	7: 49,461,957	D737G	probably damaging	Het
Ndst4	T	A	3: 125,611,506	V470D	probably damaging	Het
Nek5	T	A	8: 22,111,210	Y165F	probably damaging	Het
Nek5	A	T	8: 22,120,843	V48E	probably damaging	Het
Nr6a1	T	C	2: 38,760,388	I77V	probably damaging	Het
Nvl	A	T	1: 181,139,073	D93E	probably benign	Het
Olfr450	A	G	6: 42,818,016	T182A	probably benign	Het
Olfr552	A	T	7: 102,604,430	L25F	probably damaging	Het
Olfr656	A	T	7: 104,617,666	T4S	probably benign	Het
Olfr678	A	G	7: 105,069,392		probably benign	Het
Olfr780	A	T	10: 129,322,390	I256F	probably damaging	Het
Olfr96	C	A	17: 37,225,455	T110K	possibly damaging	Het
Pla2g4c	G	A	7: 13,339,702	V225I	probably benign	Het
Plppr4	T	A	3: 117,323,041	N331I	probably damaging	Het
Ptpn13	A	G	5: 103,579,805	R2051G	probably benign	Het
Rbm45	T	C	2: 76,378,724	S346P	probably damaging	Het
Samd14	A	C	11: 95,021,201	D168A	probably damaging	Het
Slc15a1	C	T	14: 121,486,679	G172R	probably benign	Het
Slco3a1	G	T	7: 74,284,500	Y641*	probably null	Het
Srcap	G	A	7: 127,552,394	R2027H	probably damaging	Het
Stra8	A	T	6: 34,927,689		probably benign	Het
Syt11	T	C	3: 88,747,704	Y430C	probably damaging	Het
Tanc1	T	G	2: 59,785,456	V269G	possibly damaging	Het
Tead1	A	G	7: 112,898,611	N342S	probably benign	Het
Tenm3	C	T	8: 48,279,060	A1254T	possibly damaging	Het
Txlnb	A	T	10: 17,806,798	N156I	probably damaging	Het
Ufl1	A	T	4: 25,262,258	S409R	possibly damaging	Het
Usp17la	A	G	7: 104,861,100	H304R	probably benign	Het
Vmn1r203	T	A	13: 22,524,521	H157Q	possibly damaging	Het
Vmn1r37	C	T	6: 66,732,247	R249*	probably null	Het
Vmn2r96	A	G	17: 18,583,979	Q497R	probably benign	Het
Vps39	A	G	2: 120,338,585	S292P	probably benign	Het
Wnk1	A	G	6: 120,036,998	V212A	probably damaging	Het
Xbp1	T	C	11: 5,524,741	V161A	probably benign	Het
Zfp113	T	C	5: 138,144,830	Q386R	probably damaging	Het

Other mutations in Ache

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02323:Ache	APN	5	137291064	missense	probably damaging	1.00
IGL02833:Ache	APN	5	137291109	unclassified	probably benign
R0058:Ache	UTSW	5	137290842	missense	probably damaging	1.00
R0358:Ache	UTSW	5	137290373	missense	probably benign	0.21
R0377:Ache	UTSW	5	137290928	missense	possibly damaging	0.54
R0780:Ache	UTSW	5	137290532	missense	probably damaging	1.00
R1233:Ache	UTSW	5	137290157	splice site	probably null
R1702:Ache	UTSW	5	137290989	missense	possibly damaging	0.94
R1762:Ache	UTSW	5	137290575	missense	possibly damaging	0.91
R4191:Ache	UTSW	5	137291072	missense	probably damaging	0.98
R4226:Ache	UTSW	5	137290890	missense	possibly damaging	0.83
R4499:Ache	UTSW	5	137291932	missense	probably damaging	0.98
R4931:Ache	UTSW	5	137291914	missense	probably benign	0.00
R5411:Ache	UTSW	5	137290064	missense	possibly damaging	0.93
R5411:Ache	UTSW	5	137290430	splice site	probably null
R5698:Ache	UTSW	5	137290559	missense	probably damaging	1.00
R6153:Ache	UTSW	5	137291855	missense	probably damaging	1.00
R6526:Ache	UTSW	5	137290644	missense	probably damaging	1.00
R6896:Ache	UTSW	5	137291734	missense	probably damaging	0.98
R6981:Ache	UTSW	5	137291678	missense	probably benign
R7199:Ache	UTSW	5	137290242	missense	probably damaging	1.00
R7208:Ache	UTSW	5	137291489	missense	probably damaging	1.00
R8200:Ache	UTSW	5	137294195	missense	probably damaging	1.00
R8338:Ache	UTSW	5	137291744	missense	probably damaging	1.00
R8461:Ache	UTSW	5	137290320	missense	probably damaging	0.96
R9146:Ache	UTSW	5	137290815	missense	probably damaging	1.00
R9376:Ache	UTSW	5	137290763	missense	probably benign
R9439:Ache	UTSW	5	137290923	missense	probably damaging	0.97
X0061:Ache	UTSW	5	137290095	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCTCCCAGCAGACACCAG -3'
(R):5'- TACAGGCAGTCTTCACTCAAC -3'

Sequencing Primer
(F):5'- AGACACCAGCCTGTCCTG -3'
(R):5'- GGGGTTCCACATCTCAGTAC -3'

Posted On

2021-08-31