Mutagenetix > Incidental Mutation

Incidental Mutation 'R8933:Nav2'

680444

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

068709-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.483) question?

Stock #

R8933 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49461957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 737 (D737G)

Ref Sequence

ENSEMBL: ENSMUSP00000139045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]

AlphaFold

E9Q842

Predicted Effect

probably damaging
Transcript: ENSMUST00000064395
AA Change: D737G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: D737G

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183659
AA Change: D676G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: D676G

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184124

Predicted Effect

probably damaging
Transcript: ENSMUST00000184945
AA Change: D737G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: D737G

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,128,137	I1114N	probably damaging	Het
Ache	C	A	5: 137,290,187	R52S	possibly damaging	Het
AI182371	A	T	2: 35,085,702		probably null	Het
Ankrd17	T	C	5: 90,258,466	S1453G	probably damaging	Het
Arvcf	A	G	16: 18,400,095	N508S	probably damaging	Het
Aurkc	A	C	7: 7,002,797	D136A	possibly damaging	Het
Bfsp2	A	G	9: 103,448,649	M265T	probably benign	Het
Bmpr1b	T	C	3: 141,856,608	T273A	probably damaging	Het
Cacnb1	T	C	11: 98,005,752	K406R	probably damaging	Het
Calcoco2	C	T	11: 96,107,426		probably benign	Het
Capza1	T	C	3: 104,840,893		probably null	Het
Ccdc63	T	A	5: 122,113,202	I382F	probably damaging	Het
Cep350	A	T	1: 155,863,415	N2227K	probably benign	Het
Chia1	T	A	3: 106,129,017	Y304*	probably null	Het
Col5a2	G	A	1: 45,421,963	P258L		Het
Cyp21a1	A	G	17: 34,804,311	L30P	probably damaging	Het
Dennd4b	T	A	3: 90,279,216	H1351Q	probably benign	Het
Dnah9	T	A	11: 65,855,252	I4012F	possibly damaging	Het
Drd1	A	G	13: 54,053,271	I301T	possibly damaging	Het
Dzip1	T	A	14: 118,906,914	H369L	probably damaging	Het
Fgfrl1	T	A	5: 108,703,391	M58K	probably damaging	Het
Ftsj3	G	T	11: 106,250,834	D529E	probably benign	Het
Fut9	A	T	4: 25,619,861	W318R	probably damaging	Het
Gabrg3	A	G	7: 56,984,958	I159T	probably damaging	Het
Gabrr1	A	T	4: 33,146,972	D53V	probably benign	Het
Ggps1	A	G	13: 14,054,343	V85A	probably benign	Het
Gm5141	C	T	13: 62,777,040	W18*	probably null	Het
Grik5	T	A	7: 25,023,318	T518S	probably benign	Het
Hapln3	A	T	7: 79,117,630		probably benign	Het
Hbs1l	C	T	10: 21,367,685	Q646*	probably null	Het
Hmox1	T	C	8: 75,097,016	I104T	probably benign	Het
Ifit1bl1	T	C	19: 34,594,013	Y348C	probably damaging	Het
Igf2r	A	T	17: 12,701,244	S1403T	probably damaging	Het
Igf2r	G	A	17: 12,704,637	T1186M	probably damaging	Het
Igfbp1	T	C	11: 7,198,333		probably null	Het
Ikbip	C	A	10: 91,083,230	A35E	probably benign	Het
Isca1	C	T	13: 59,769,683	A8T	probably damaging	Het
Itgb2	T	C	10: 77,565,188	L754P	probably damaging	Het
Itgb6	C	T	2: 60,627,903	C502Y	probably damaging	Het
Kdm3a	A	G	6: 71,600,108	V741A	probably benign	Het
Kdsr	T	C	1: 106,753,219	D83G	possibly damaging	Het
Kiz	T	A	2: 146,942,117	N523K		Het
Kmt2a	T	C	9: 44,822,505		probably benign	Het
Krt25	T	C	11: 99,321,238	E191G	probably benign	Het
Lipn	A	G	19: 34,069,480	I61V	probably damaging	Het
Lmbr1l	T	A	15: 98,909,269		probably null	Het
Lrrc4c	A	G	2: 97,629,481	K151E	probably benign	Het
Mab21l3	T	C	3: 101,823,458	Q155R	probably benign	Het
Mtfr2	G	A	10: 20,357,528	R281H	possibly damaging	Het
Muc5ac	A	G	7: 141,789,756	Y35C	possibly damaging	Het
Myadm	C	T	7: 3,296,917	T65I	probably benign	Het
Nap1l1	T	C	10: 111,492,849	V213A	probably benign	Het
Ndst4	T	A	3: 125,611,506	V470D	probably damaging	Het
Nek5	T	A	8: 22,111,210	Y165F	probably damaging	Het
Nek5	A	T	8: 22,120,843	V48E	probably damaging	Het
Nr6a1	T	C	2: 38,760,388	I77V	probably damaging	Het
Nvl	A	T	1: 181,139,073	D93E	probably benign	Het
Olfr450	A	G	6: 42,818,016	T182A	probably benign	Het
Olfr552	A	T	7: 102,604,430	L25F	probably damaging	Het
Olfr656	A	T	7: 104,617,666	T4S	probably benign	Het
Olfr678	A	G	7: 105,069,392		probably benign	Het
Olfr780	A	T	10: 129,322,390	I256F	probably damaging	Het
Olfr96	C	A	17: 37,225,455	T110K	possibly damaging	Het
Pla2g4c	G	A	7: 13,339,702	V225I	probably benign	Het
Plppr4	T	A	3: 117,323,041	N331I	probably damaging	Het
Ptpn13	A	G	5: 103,579,805	R2051G	probably benign	Het
Rbm45	T	C	2: 76,378,724	S346P	probably damaging	Het
Samd14	A	C	11: 95,021,201	D168A	probably damaging	Het
Slc15a1	C	T	14: 121,486,679	G172R	probably benign	Het
Slco3a1	G	T	7: 74,284,500	Y641*	probably null	Het
Srcap	G	A	7: 127,552,394	R2027H	probably damaging	Het
Stra8	A	T	6: 34,927,689		probably benign	Het
Syt11	T	C	3: 88,747,704	Y430C	probably damaging	Het
Tanc1	T	G	2: 59,785,456	V269G	possibly damaging	Het
Tead1	A	G	7: 112,898,611	N342S	probably benign	Het
Tenm3	C	T	8: 48,279,060	A1254T	possibly damaging	Het
Txlnb	A	T	10: 17,806,798	N156I	probably damaging	Het
Ufl1	A	T	4: 25,262,258	S409R	possibly damaging	Het
Usp17la	A	G	7: 104,861,100	H304R	probably benign	Het
Vmn1r203	T	A	13: 22,524,521	H157Q	possibly damaging	Het
Vmn1r37	C	T	6: 66,732,247	R249*	probably null	Het
Vmn2r96	A	G	17: 18,583,979	Q497R	probably benign	Het
Vps39	A	G	2: 120,338,585	S292P	probably benign	Het
Wnk1	A	G	6: 120,036,998	V212A	probably damaging	Het
Xbp1	T	C	11: 5,524,741	V161A	probably benign	Het
Zfp113	T	C	5: 138,144,830	Q386R	probably damaging	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8110:Nav2	UTSW	7	49551950	nonsense	probably null
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
R8835:Nav2	UTSW	7	49598803	missense	possibly damaging	0.83
R8957:Nav2	UTSW	7	49571216	missense	probably damaging	1.00
R9069:Nav2	UTSW	7	49558813	missense	probably damaging	0.99
R9095:Nav2	UTSW	7	49604545	missense	probably damaging	1.00
R9223:Nav2	UTSW	7	49552851	missense	probably damaging	1.00
R9261:Nav2	UTSW	7	49597156	missense	probably damaging	1.00
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCAGACAGATAGACACGTCG -3'
(R):5'- CAAGGGTTTCTATTCCACTCTCAAC -3'

Sequencing Primer
(F):5'- GACACGTCGGTATCTATCCAATGTG -3'
(R):5'- CTCTCAACCAAACCACTTTGTG -3'

Posted On

2021-08-31