Incidental Mutation 'R8933:Or52p1'
ID 680448
Institutional Source Beutler Lab
Gene Symbol Or52p1
Ensembl Gene ENSMUSG00000073924
Gene Name olfactory receptor family 52 subfamily P member 1
Synonyms MOR27-1, Olfr656, GA_x6K02T2PBJ9-7245486-7246451
MMRRC Submission 068709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104266864-104267853 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104266873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 4 (T4S)
Ref Sequence ENSEMBL: ENSMUSP00000095774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
AlphaFold Q8VGX9
Predicted Effect probably benign
Transcript: ENSMUST00000098172
AA Change: T4S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: T4S

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215575
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,921,786 (GRCm39) I1114N probably damaging Het
Ache C A 5: 137,288,449 (GRCm39) R52S possibly damaging Het
AI182371 A T 2: 34,975,714 (GRCm39) probably null Het
Ankrd17 T C 5: 90,406,325 (GRCm39) S1453G probably damaging Het
Arvcf A G 16: 18,218,845 (GRCm39) N508S probably damaging Het
Aurkc A C 7: 7,005,796 (GRCm39) D136A possibly damaging Het
Bfsp2 A G 9: 103,325,848 (GRCm39) M265T probably benign Het
Bmpr1b T C 3: 141,562,369 (GRCm39) T273A probably damaging Het
Cacnb1 T C 11: 97,896,578 (GRCm39) K406R probably damaging Het
Calcoco2 C T 11: 95,998,252 (GRCm39) probably benign Het
Capza1 T C 3: 104,748,209 (GRCm39) probably null Het
Ccdc63 T A 5: 122,251,265 (GRCm39) I382F probably damaging Het
Cep350 A T 1: 155,739,161 (GRCm39) N2227K probably benign Het
Chia1 T A 3: 106,036,333 (GRCm39) Y304* probably null Het
Col5a2 G A 1: 45,461,123 (GRCm39) P258L Het
Cyp21a1 A G 17: 35,023,285 (GRCm39) L30P probably damaging Het
Dennd4b T A 3: 90,186,523 (GRCm39) H1351Q probably benign Het
Dnah9 T A 11: 65,746,078 (GRCm39) I4012F possibly damaging Het
Drd1 A G 13: 54,207,290 (GRCm39) I301T possibly damaging Het
Dzip1 T A 14: 119,144,326 (GRCm39) H369L probably damaging Het
Fgfrl1 T A 5: 108,851,257 (GRCm39) M58K probably damaging Het
Ftsj3 G T 11: 106,141,660 (GRCm39) D529E probably benign Het
Fut9 A T 4: 25,619,861 (GRCm39) W318R probably damaging Het
Gabrg3 A G 7: 56,634,706 (GRCm39) I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 (GRCm39) D53V probably benign Het
Ggps1 A G 13: 14,228,928 (GRCm39) V85A probably benign Het
Gm5141 C T 13: 62,924,854 (GRCm39) W18* probably null Het
Grik5 T A 7: 24,722,743 (GRCm39) T518S probably benign Het
Hapln3 A T 7: 78,767,378 (GRCm39) probably benign Het
Hbs1l C T 10: 21,243,584 (GRCm39) Q646* probably null Het
Hmox1 T C 8: 75,823,644 (GRCm39) I104T probably benign Het
Ifit1bl1 T C 19: 34,571,413 (GRCm39) Y348C probably damaging Het
Igf2r A T 17: 12,920,131 (GRCm39) S1403T probably damaging Het
Igf2r G A 17: 12,923,524 (GRCm39) T1186M probably damaging Het
Igfbp1 T C 11: 7,148,333 (GRCm39) probably null Het
Ikbip C A 10: 90,919,092 (GRCm39) A35E probably benign Het
Isca1 C T 13: 59,917,497 (GRCm39) A8T probably damaging Het
Itgb2 T C 10: 77,401,022 (GRCm39) L754P probably damaging Het
Itgb6 C T 2: 60,458,247 (GRCm39) C502Y probably damaging Het
Kdm3a A G 6: 71,577,092 (GRCm39) V741A probably benign Het
Kdsr T C 1: 106,680,949 (GRCm39) D83G possibly damaging Het
Kiz T A 2: 146,784,037 (GRCm39) N523K Het
Kmt2a T C 9: 44,733,802 (GRCm39) probably benign Het
Krt25 T C 11: 99,212,064 (GRCm39) E191G probably benign Het
Lipn A G 19: 34,046,880 (GRCm39) I61V probably damaging Het
Lmbr1l T A 15: 98,807,150 (GRCm39) probably null Het
Lrrc4c A G 2: 97,459,826 (GRCm39) K151E probably benign Het
Mab21l3 T C 3: 101,730,774 (GRCm39) Q155R probably benign Het
Mtfr2 G A 10: 20,233,274 (GRCm39) R281H possibly damaging Het
Muc5ac A G 7: 141,343,493 (GRCm39) Y35C possibly damaging Het
Myadm C T 7: 3,345,433 (GRCm39) T65I probably benign Het
Nap1l1 T C 10: 111,328,710 (GRCm39) V213A probably benign Het
Nav2 A G 7: 49,111,705 (GRCm39) D737G probably damaging Het
Ndst4 T A 3: 125,405,155 (GRCm39) V470D probably damaging Het
Nek5 T A 8: 22,601,226 (GRCm39) Y165F probably damaging Het
Nek5 A T 8: 22,610,859 (GRCm39) V48E probably damaging Het
Nr6a1 T C 2: 38,650,400 (GRCm39) I77V probably damaging Het
Nvl A T 1: 180,966,638 (GRCm39) D93E probably benign Het
Or11a4 C A 17: 37,536,346 (GRCm39) T110K possibly damaging Het
Or2q1 A G 6: 42,794,950 (GRCm39) T182A probably benign Het
Or52e5 A G 7: 104,718,599 (GRCm39) probably benign Het
Or52k2 A T 7: 102,253,637 (GRCm39) L25F probably damaging Het
Or6c68 A T 10: 129,158,259 (GRCm39) I256F probably damaging Het
Pla2g4c G A 7: 13,073,627 (GRCm39) V225I probably benign Het
Plppr4 T A 3: 117,116,690 (GRCm39) N331I probably damaging Het
Ptpn13 A G 5: 103,727,671 (GRCm39) R2051G probably benign Het
Rbm45 T C 2: 76,209,068 (GRCm39) S346P probably damaging Het
Samd14 A C 11: 94,912,027 (GRCm39) D168A probably damaging Het
Slc15a1 C T 14: 121,724,091 (GRCm39) G172R probably benign Het
Slco3a1 G T 7: 73,934,248 (GRCm39) Y641* probably null Het
Srcap G A 7: 127,151,566 (GRCm39) R2027H probably damaging Het
Stra8 A T 6: 34,904,624 (GRCm39) probably benign Het
Syt11 T C 3: 88,655,011 (GRCm39) Y430C probably damaging Het
Tanc1 T G 2: 59,615,800 (GRCm39) V269G possibly damaging Het
Tead1 A G 7: 112,497,818 (GRCm39) N342S probably benign Het
Tenm3 C T 8: 48,732,095 (GRCm39) A1254T possibly damaging Het
Txlnb A T 10: 17,682,546 (GRCm39) N156I probably damaging Het
Ufl1 A T 4: 25,262,258 (GRCm39) S409R possibly damaging Het
Usp17la A G 7: 104,510,307 (GRCm39) H304R probably benign Het
Vmn1r203 T A 13: 22,708,691 (GRCm39) H157Q possibly damaging Het
Vmn1r37 C T 6: 66,709,231 (GRCm39) R249* probably null Het
Vmn2r96 A G 17: 18,804,241 (GRCm39) Q497R probably benign Het
Vps39 A G 2: 120,169,066 (GRCm39) S292P probably benign Het
Wnk1 A G 6: 120,013,959 (GRCm39) V212A probably damaging Het
Xbp1 T C 11: 5,474,741 (GRCm39) V161A probably benign Het
Zfp113 T C 5: 138,143,092 (GRCm39) Q386R probably damaging Het
Other mutations in Or52p1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Or52p1 APN 7 104,266,928 (GRCm39) missense probably damaging 0.98
IGL01908:Or52p1 APN 7 104,266,906 (GRCm39) missense probably damaging 1.00
IGL02695:Or52p1 APN 7 104,267,678 (GRCm39) missense probably damaging 1.00
IGL03055:Or52p1 UTSW 7 104,267,413 (GRCm39) missense probably damaging 1.00
R0128:Or52p1 UTSW 7 104,267,788 (GRCm39) missense probably damaging 1.00
R0184:Or52p1 UTSW 7 104,267,447 (GRCm39) missense probably damaging 1.00
R4674:Or52p1 UTSW 7 104,267,631 (GRCm39) nonsense probably null
R4675:Or52p1 UTSW 7 104,267,631 (GRCm39) nonsense probably null
R4723:Or52p1 UTSW 7 104,267,696 (GRCm39) missense possibly damaging 0.56
R4979:Or52p1 UTSW 7 104,267,812 (GRCm39) missense probably null 0.03
R6273:Or52p1 UTSW 7 104,267,102 (GRCm39) missense probably damaging 1.00
R6359:Or52p1 UTSW 7 104,267,510 (GRCm39) missense probably damaging 1.00
R6582:Or52p1 UTSW 7 104,267,648 (GRCm39) missense probably damaging 1.00
R6750:Or52p1 UTSW 7 104,267,320 (GRCm39) missense probably damaging 0.99
R7426:Or52p1 UTSW 7 104,267,059 (GRCm39) missense probably damaging 1.00
R7786:Or52p1 UTSW 7 104,266,925 (GRCm39) missense probably benign 0.02
R8068:Or52p1 UTSW 7 104,267,460 (GRCm39) nonsense probably null
R8324:Or52p1 UTSW 7 104,267,321 (GRCm39) missense probably benign 0.00
R8486:Or52p1 UTSW 7 104,267,069 (GRCm39) missense possibly damaging 0.47
R8828:Or52p1 UTSW 7 104,267,486 (GRCm39) missense probably damaging 1.00
R8971:Or52p1 UTSW 7 104,267,467 (GRCm39) missense probably damaging 1.00
R9329:Or52p1 UTSW 7 104,267,705 (GRCm39) missense probably damaging 1.00
X0065:Or52p1 UTSW 7 104,266,965 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCGTTAGCTAGTCTGAAATTG -3'
(R):5'- TCTGTGCAAGGTTGGCTCAG -3'

Sequencing Primer
(F):5'- CGTTAGCTAGTCTGAAATTGTAAGTC -3'
(R):5'- GTGAGAGCCACATATGGA -3'
Posted On 2021-08-31