Incidental Mutation 'R8933:Gm5141'
ID 680479
Institutional Source Beutler Lab
Gene Symbol Gm5141
Ensembl Gene ENSMUSG00000091183
Gene Name predicted gene 5141
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 62772200-62785808 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 62777040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 18 (W18*)
Ref Sequence ENSEMBL: ENSMUSP00000144368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167516] [ENSMUST00000201047]
AlphaFold A0A0J9YUW3
Predicted Effect probably null
Transcript: ENSMUST00000167516
AA Change: W17*
SMART Domains Protein: ENSMUSP00000126604
Gene: ENSMUSG00000091183
AA Change: W17*

DomainStartEndE-ValueType
KRAB 3 65 2.32e-19 SMART
ZnF_C2H2 132 154 1.51e0 SMART
ZnF_C2H2 160 182 6.52e-5 SMART
ZnF_C2H2 188 210 5.42e-2 SMART
ZnF_C2H2 216 238 1.84e-4 SMART
ZnF_C2H2 244 266 1.3e-4 SMART
ZnF_C2H2 272 294 1.22e-4 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 3.89e-3 SMART
ZnF_C2H2 384 406 4.94e-5 SMART
ZnF_C2H2 412 434 5.67e-5 SMART
ZnF_C2H2 440 462 7.49e-5 SMART
ZnF_C2H2 468 490 5.21e-4 SMART
ZnF_C2H2 496 518 4.87e-4 SMART
ZnF_C2H2 524 546 1.22e-4 SMART
ZnF_C2H2 552 574 1.18e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201047
AA Change: W18*
SMART Domains Protein: ENSMUSP00000144368
Gene: ENSMUSG00000091183
AA Change: W18*

DomainStartEndE-ValueType
KRAB 4 66 9.8e-22 SMART
ZnF_C2H2 133 155 6.5e-3 SMART
ZnF_C2H2 161 183 2.7e-7 SMART
ZnF_C2H2 189 211 2.4e-4 SMART
ZnF_C2H2 217 239 8.1e-7 SMART
ZnF_C2H2 245 267 5.6e-7 SMART
ZnF_C2H2 273 295 5.1e-7 SMART
ZnF_C2H2 301 323 7.9e-6 SMART
ZnF_C2H2 329 351 1.2e-6 SMART
ZnF_C2H2 357 379 1.7e-5 SMART
ZnF_C2H2 385 407 2.1e-7 SMART
ZnF_C2H2 413 435 2.4e-7 SMART
ZnF_C2H2 441 463 3.2e-7 SMART
ZnF_C2H2 469 491 2.2e-6 SMART
ZnF_C2H2 497 519 2.2e-6 SMART
ZnF_C2H2 525 547 5.4e-7 SMART
ZnF_C2H2 553 575 4.9e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,128,137 I1114N probably damaging Het
Ache C A 5: 137,290,187 R52S possibly damaging Het
AI182371 A T 2: 35,085,702 probably null Het
Ankrd17 T C 5: 90,258,466 S1453G probably damaging Het
Arvcf A G 16: 18,400,095 N508S probably damaging Het
Aurkc A C 7: 7,002,797 D136A possibly damaging Het
Bfsp2 A G 9: 103,448,649 M265T probably benign Het
Bmpr1b T C 3: 141,856,608 T273A probably damaging Het
Cacnb1 T C 11: 98,005,752 K406R probably damaging Het
Calcoco2 C T 11: 96,107,426 probably benign Het
Capza1 T C 3: 104,840,893 probably null Het
Ccdc63 T A 5: 122,113,202 I382F probably damaging Het
Cep350 A T 1: 155,863,415 N2227K probably benign Het
Chia1 T A 3: 106,129,017 Y304* probably null Het
Col5a2 G A 1: 45,421,963 P258L Het
Cyp21a1 A G 17: 34,804,311 L30P probably damaging Het
Dennd4b T A 3: 90,279,216 H1351Q probably benign Het
Dnah9 T A 11: 65,855,252 I4012F possibly damaging Het
Drd1 A G 13: 54,053,271 I301T possibly damaging Het
Dzip1 T A 14: 118,906,914 H369L probably damaging Het
Fgfrl1 T A 5: 108,703,391 M58K probably damaging Het
Ftsj3 G T 11: 106,250,834 D529E probably benign Het
Fut9 A T 4: 25,619,861 W318R probably damaging Het
Gabrg3 A G 7: 56,984,958 I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 D53V probably benign Het
Ggps1 A G 13: 14,054,343 V85A probably benign Het
Grik5 T A 7: 25,023,318 T518S probably benign Het
Hapln3 A T 7: 79,117,630 probably benign Het
Hbs1l C T 10: 21,367,685 Q646* probably null Het
Hmox1 T C 8: 75,097,016 I104T probably benign Het
Ifit1bl1 T C 19: 34,594,013 Y348C probably damaging Het
Igf2r A T 17: 12,701,244 S1403T probably damaging Het
Igf2r G A 17: 12,704,637 T1186M probably damaging Het
Igfbp1 T C 11: 7,198,333 probably null Het
Ikbip C A 10: 91,083,230 A35E probably benign Het
Isca1 C T 13: 59,769,683 A8T probably damaging Het
Itgb2 T C 10: 77,565,188 L754P probably damaging Het
Itgb6 C T 2: 60,627,903 C502Y probably damaging Het
Kdm3a A G 6: 71,600,108 V741A probably benign Het
Kdsr T C 1: 106,753,219 D83G possibly damaging Het
Kiz T A 2: 146,942,117 N523K Het
Kmt2a T C 9: 44,822,505 probably benign Het
Krt25 T C 11: 99,321,238 E191G probably benign Het
Lipn A G 19: 34,069,480 I61V probably damaging Het
Lmbr1l T A 15: 98,909,269 probably null Het
Lrrc4c A G 2: 97,629,481 K151E probably benign Het
Mab21l3 T C 3: 101,823,458 Q155R probably benign Het
Mtfr2 G A 10: 20,357,528 R281H possibly damaging Het
Muc5ac A G 7: 141,789,756 Y35C possibly damaging Het
Myadm C T 7: 3,296,917 T65I probably benign Het
Nap1l1 T C 10: 111,492,849 V213A probably benign Het
Nav2 A G 7: 49,461,957 D737G probably damaging Het
Ndst4 T A 3: 125,611,506 V470D probably damaging Het
Nek5 T A 8: 22,111,210 Y165F probably damaging Het
Nek5 A T 8: 22,120,843 V48E probably damaging Het
Nr6a1 T C 2: 38,760,388 I77V probably damaging Het
Nvl A T 1: 181,139,073 D93E probably benign Het
Olfr450 A G 6: 42,818,016 T182A probably benign Het
Olfr552 A T 7: 102,604,430 L25F probably damaging Het
Olfr656 A T 7: 104,617,666 T4S probably benign Het
Olfr678 A G 7: 105,069,392 probably benign Het
Olfr780 A T 10: 129,322,390 I256F probably damaging Het
Olfr96 C A 17: 37,225,455 T110K possibly damaging Het
Pla2g4c G A 7: 13,339,702 V225I probably benign Het
Plppr4 T A 3: 117,323,041 N331I probably damaging Het
Ptpn13 A G 5: 103,579,805 R2051G probably benign Het
Rbm45 T C 2: 76,378,724 S346P probably damaging Het
Samd14 A C 11: 95,021,201 D168A probably damaging Het
Slc15a1 C T 14: 121,486,679 G172R probably benign Het
Slco3a1 G T 7: 74,284,500 Y641* probably null Het
Srcap G A 7: 127,552,394 R2027H probably damaging Het
Stra8 A T 6: 34,927,689 probably benign Het
Syt11 T C 3: 88,747,704 Y430C probably damaging Het
Tanc1 T G 2: 59,785,456 V269G possibly damaging Het
Tead1 A G 7: 112,898,611 N342S probably benign Het
Tenm3 C T 8: 48,279,060 A1254T possibly damaging Het
Txlnb A T 10: 17,806,798 N156I probably damaging Het
Ufl1 A T 4: 25,262,258 S409R possibly damaging Het
Usp17la A G 7: 104,861,100 H304R probably benign Het
Vmn1r203 T A 13: 22,524,521 H157Q possibly damaging Het
Vmn1r37 C T 6: 66,732,247 R249* probably null Het
Vmn2r96 A G 17: 18,583,979 Q497R probably benign Het
Vps39 A G 2: 120,338,585 S292P probably benign Het
Wnk1 A G 6: 120,036,998 V212A probably damaging Het
Xbp1 T C 11: 5,524,741 V161A probably benign Het
Zfp113 T C 5: 138,144,830 Q386R probably damaging Het
Other mutations in Gm5141
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0220:Gm5141 UTSW 13 62774457 missense probably damaging 1.00
R0427:Gm5141 UTSW 13 62774711 missense probably damaging 1.00
R0534:Gm5141 UTSW 13 62774594 missense probably damaging 1.00
R0652:Gm5141 UTSW 13 62774132 missense probably damaging 1.00
R1495:Gm5141 UTSW 13 62774270 missense probably damaging 1.00
R2079:Gm5141 UTSW 13 62774610 missense probably benign 0.06
R4780:Gm5141 UTSW 13 62774950 missense unknown
R5588:Gm5141 UTSW 13 62773770 missense probably benign 0.06
R6292:Gm5141 UTSW 13 62774438 missense probably damaging 1.00
R6455:Gm5141 UTSW 13 62774783 missense probably damaging 1.00
R6605:Gm5141 UTSW 13 62774387 missense probably damaging 1.00
R7091:Gm5141 UTSW 13 62773964 missense possibly damaging 0.80
R7199:Gm5141 UTSW 13 62777063 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGCTAATCTACACTGCTCCTTT -3'
(R):5'- CAGTAGAACTTGGGTGTGAGTAAATA -3'

Sequencing Primer
(F):5'- CAGATTTGTATGAGCTTGCACATG -3'
(R):5'- CTTGGGTGTGAGTAAATAAGTGGGAC -3'
Posted On 2021-08-31